\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211103816:

Variant ID: vg1211103816 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11103816
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GCCATTGGGTCGTCATGGTTTTCTGAGGACGTCCACATTCCCGCCTCTTAGGAAGTGGTTCCATCAGCATAAAAATCATCATGCAATATCCCATCCCACA[C/T]
AAGTTAAAGAATTTAGAGTCTAGCCAAGTGTAATACATGTCCCGGTGCTCAATAACCGTGAGCACGGCTATTCGAATAGATTTGGTTTACTCACACTGCA

Reverse complement sequence

TGCAGTGTGAGTAAACCAAATCTATTCGAATAGCCGTGCTCACGGTTATTGAGCACCGGGACATGTATTACACTTGGCTAGACTCTAAATTCTTTAACTT[G/A]
TGTGGGATGGGATATTGCATGATGATTTTTATGCTGATGGAACCACTTCCTAAGAGGCGGGAATGTGGACGTCCTCAGAAAACCATGACGACCCAATGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 28.10% 0.36% 0.00% NA
All Indica  2759 76.40% 23.00% 0.54% 0.00% NA
All Japonica  1512 56.30% 43.70% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 96.50% 3.20% 0.34% 0.00% NA
Indica II  465 61.90% 36.80% 1.29% 0.00% NA
Indica III  913 74.70% 24.90% 0.44% 0.00% NA
Indica Intermediate  786 71.90% 27.70% 0.38% 0.00% NA
Temperate Japonica  767 22.60% 77.40% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211103816 C -> T LOC_Os12g19130.1 upstream_gene_variant ; 2463.0bp to feature; MODIFIER silent_mutation Average:19.529; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 N N N N
vg1211103816 C -> T LOC_Os12g19120.1 downstream_gene_variant ; 1671.0bp to feature; MODIFIER silent_mutation Average:19.529; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 N N N N
vg1211103816 C -> T LOC_Os12g19120-LOC_Os12g19130 intergenic_region ; MODIFIER silent_mutation Average:19.529; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211103816 NA 2.76E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 7.01E-10 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 7.56E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 8.29E-17 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 1.75E-15 mr1079 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 2.04E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 5.60E-16 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 6.49E-11 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 9.73E-18 mr1489 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 8.74E-17 mr1491 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 1.75E-16 mr1778 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 9.85E-11 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 9.73E-20 mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 2.08E-16 mr1079_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 4.55E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 1.74E-18 mr1489_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 4.02E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 2.09E-16 mr1778_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211103816 NA 2.56E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251