Variant ID: vg1211097492 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 11097492 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 120. )
CAGCTCAGCATCAACAGCAAAGTCAACTAAAGATTTTTCGGACATTCTGAAAACTTCTCAGACAAGTCCGAAAACAACCTTCTGTACGTTTCTGGGAAGT[C/T]
CGAAAAAACACAGAAGTGATTTTGACTCTACTGAGGATTTTCGGAAAAACCGAAAATCAATTTCGGACAAGTCCGAAAATATACAGAACCACTTTTGCCC
GGGCAAAAGTGGTTCTGTATATTTTCGGACTTGTCCGAAATTGATTTTCGGTTTTTCCGAAAATCCTCAGTAGAGTCAAAATCACTTCTGTGTTTTTTCG[G/A]
ACTTCCCAGAAACGTACAGAAGGTTGTTTTCGGACTTGTCTGAGAAGTTTTCAGAATGTCCGAAAAATCTTTAGTTGACTTTGCTGTTGATGCTGAGCTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.80% | 35.20% | 0.02% | 0.00% | NA |
All Indica | 2759 | 75.30% | 24.70% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 59.30% | 40.60% | 0.07% | 0.00% | NA |
Aus | 269 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 77.00% | 23.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 17.30% | 82.50% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 58.10% | 41.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1211097492 | C -> T | LOC_Os12g19120.1 | upstream_gene_variant ; 3394.0bp to feature; MODIFIER | silent_mutation | Average:27.656; most accessible tissue: Callus, score: 58.223 | N | N | N | N |
vg1211097492 | C -> T | LOC_Os12g19110-LOC_Os12g19120 | intergenic_region ; MODIFIER | silent_mutation | Average:27.656; most accessible tissue: Callus, score: 58.223 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1211097492 | NA | 1.41E-07 | mr1460 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 4.48E-06 | mr1616 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 6.97E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 9.18E-06 | mr1639 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 8.86E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 1.42E-12 | mr1706 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 2.67E-07 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 4.50E-07 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 7.12E-06 | mr1358_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1211097492 | NA | 4.04E-07 | mr1578_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |