Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211085119:

Variant ID: vg1211085119 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 11085119
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGGCCGCCACCGCCTGCCCCGTCATCGGAGGGCTCGAGGAGGACGCCGGCGTGGAGGAGCCCCGGGCAGCAGACGGAGAGCTTGTGGAGCGCGGCCCA[C/T]
GCCCTGGGCGCGTTGTCAGGTAGCCGTCCCCTGCACGCACCGACTACCACCGGAAGACAAGCAAGCAAGGAAGCAAGCAAGGAAGACGACATGAATACAC

Reverse complement sequence

GTGTATTCATGTCGTCTTCCTTGCTTGCTTCCTTGCTTGCTTGTCTTCCGGTGGTAGTCGGTGCGTGCAGGGGACGGCTACCTGACAACGCGCCCAGGGC[G/A]
TGGGCCGCGCTCCACAAGCTCTCCGTCTGCTGCCCGGGGCTCCTCCACGCCGGCGTCCTCCTCGAGCCCTCCGATGACGGGGCAGGCGGTGGCGGCCATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	0.30%	8.55%	34.43%	NA
All Indica	2759	43.10%	0.50%	13.37%	43.02%	NA
All Japonica	1512	79.90%	0.00%	1.85%	18.25%	NA
Aus	269	61.70%	0.00%	0.74%	37.55%	NA
Indica I	595	35.50%	0.70%	9.58%	54.29%	NA
Indica II	465	40.90%	0.00%	14.84%	44.30%	NA
Indica III	913	48.60%	0.90%	17.09%	33.41%	NA
Indica Intermediate	786	43.60%	0.40%	11.07%	44.91%	NA
Temperate Japonica	767	85.40%	0.00%	2.74%	11.86%	NA
Tropical Japonica	504	72.40%	0.00%	1.39%	26.19%	NA
Japonica Intermediate	241	78.00%	0.00%	0.00%	21.99%	NA
VI/Aromatic	96	56.20%	0.00%	4.17%	39.58%	NA
Intermediate	90	71.10%	0.00%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1211085119	C -> DEL	LOC_Os12g19100.1	N	frameshift_variant	Average:92.519; most accessible tissue: Zhenshan97 young leaf, score: 97.427	N	N	N	N
vg1211085119	C -> T	LOC_Os12g19100.1	missense_variant ; p.Arg89Cys; MODERATE	nonsynonymous_codon ; R89C	Average:92.519; most accessible tissue: Zhenshan97 young leaf, score: 97.427	unknown	unknown	DELETERIOUS	0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1211085119	C	T	0.0	0.0	0.0	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1211085119	2.61E-07	2.61E-07	mr1335_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251