\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211085119:

Variant ID: vg1211085119 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11085119
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGCCGCCACCGCCTGCCCCGTCATCGGAGGGCTCGAGGAGGACGCCGGCGTGGAGGAGCCCCGGGCAGCAGACGGAGAGCTTGTGGAGCGCGGCCCA[C/T]
GCCCTGGGCGCGTTGTCAGGTAGCCGTCCCCTGCACGCACCGACTACCACCGGAAGACAAGCAAGCAAGGAAGCAAGCAAGGAAGACGACATGAATACAC

Reverse complement sequence

GTGTATTCATGTCGTCTTCCTTGCTTGCTTCCTTGCTTGCTTGTCTTCCGGTGGTAGTCGGTGCGTGCAGGGGACGGCTACCTGACAACGCGCCCAGGGC[G/A]
TGGGCCGCGCTCCACAAGCTCTCCGTCTGCTGCCCGGGGCTCCTCCACGCCGGCGTCCTCCTCGAGCCCTCCGATGACGGGGCAGGCGGTGGCGGCCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 0.30% 8.55% 34.43% NA
All Indica  2759 43.10% 0.50% 13.37% 43.02% NA
All Japonica  1512 79.90% 0.00% 1.85% 18.25% NA
Aus  269 61.70% 0.00% 0.74% 37.55% NA
Indica I  595 35.50% 0.70% 9.58% 54.29% NA
Indica II  465 40.90% 0.00% 14.84% 44.30% NA
Indica III  913 48.60% 0.90% 17.09% 33.41% NA
Indica Intermediate  786 43.60% 0.40% 11.07% 44.91% NA
Temperate Japonica  767 85.40% 0.00% 2.74% 11.86% NA
Tropical Japonica  504 72.40% 0.00% 1.39% 26.19% NA
Japonica Intermediate  241 78.00% 0.00% 0.00% 21.99% NA
VI/Aromatic  96 56.20% 0.00% 4.17% 39.58% NA
Intermediate  90 71.10% 0.00% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211085119 C -> DEL LOC_Os12g19100.1 N frameshift_variant Average:92.519; most accessible tissue: Zhenshan97 young leaf, score: 97.427 N N N N
vg1211085119 C -> T LOC_Os12g19100.1 missense_variant ; p.Arg89Cys; MODERATE nonsynonymous_codon ; R89C Average:92.519; most accessible tissue: Zhenshan97 young leaf, score: 97.427 unknown unknown DELETERIOUS 0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1211085119 C T 0.0 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211085119 2.61E-07 2.61E-07 mr1335_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251