\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211008261:

Variant ID: vg1211008261 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11008261
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGAGGAATACCCTCCTCAGGGAATTAACTTAGGATTATATACCGGCGCGGAGGAATACCCGTACTGAGCTGTCACCATCAGCGGCCCACCTCTCATCC[G/A]
CAATATATAACCCCAAATAATGATATCCCGTAATCTAGACACCACGTCTAAACTACCATATACTACTCTAATATCATCATCATGACATAGAGTAATTGCA

Reverse complement sequence

TGCAATTACTCTATGTCATGATGATGATATTAGAGTAGTATATGGTAGTTTAGACGTGGTGTCTAGATTACGGGATATCATTATTTGGGGTTATATATTG[C/T]
GGATGAGAGGTGGGCCGCTGATGGTGACAGCTCAGTACGGGTATTCCTCCGCGCCGGTATATAATCCTAAGTTAATTCCCTGAGGAGGGTATTCCTCCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 11.30% 0.02% 0.00% NA
All Indica  2759 87.90% 12.10% 0.00% 0.00% NA
All Japonica  1512 88.20% 11.80% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 89.40% 10.60% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 83.70% 16.30% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.50% 0.00% 0.00% NA
Temperate Japonica  767 96.30% 3.70% 0.00% 0.00% NA
Tropical Japonica  504 85.70% 14.30% 0.00% 0.00% NA
Japonica Intermediate  241 67.20% 32.40% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211008261 G -> A LOC_Os12g18960.1 upstream_gene_variant ; 3956.0bp to feature; MODIFIER silent_mutation Average:47.217; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1211008261 G -> A LOC_Os12g18960.2 upstream_gene_variant ; 3950.0bp to feature; MODIFIER silent_mutation Average:47.217; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1211008261 G -> A LOC_Os12g18970.1 downstream_gene_variant ; 2226.0bp to feature; MODIFIER silent_mutation Average:47.217; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg1211008261 G -> A LOC_Os12g18960-LOC_Os12g18970 intergenic_region ; MODIFIER silent_mutation Average:47.217; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211008261 NA 1.03E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 1.85E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 6.30E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 7.20E-06 NA mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 2.74E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 9.53E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 8.48E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 8.55E-06 mr1386_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 8.40E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 3.51E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 4.53E-06 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 9.21E-07 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 8.50E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 8.15E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 3.53E-06 8.73E-08 mr1754_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211008261 NA 6.37E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251