\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210995463:

Variant ID: vg1210995463 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10995463
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AACATGTTTGAACATTCGTCTTATTTAAAAACTTTTGTAAAATATAAAACTATATATATACATAAAAGTATATTTAACAATGAATCAAATGATAGAAAAA[A/G]
AATTAATAATTACTTAAATTTTTTAAATAACATATACGGTCAACCATATTTAAAAAAGTCAACAATGTCAAATATTTAGGGACGGAGGGAGTATTATGTT

Reverse complement sequence

AACATAATACTCCCTCCGTCCCTAAATATTTGACATTGTTGACTTTTTTAAATATGGTTGACCGTATATGTTATTTAAAAAATTTAAGTAATTATTAATT[T/C]
TTTTTCTATCATTTGATTCATTGTTAAATATACTTTTATGTATATATATAGTTTTATATTTTACAAAAGTTTTTAAATAAGACGAATGTTCAAACATGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 27.40% 0.61% 0.83% NA
All Indica  2759 92.20% 5.40% 1.01% 1.41% NA
All Japonica  1512 30.80% 69.20% 0.07% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 98.00% 1.30% 0.34% 0.34% NA
Indica II  465 78.10% 18.30% 1.51% 2.15% NA
Indica III  913 95.30% 1.50% 0.99% 2.19% NA
Indica Intermediate  786 92.50% 5.30% 1.27% 0.89% NA
Temperate Japonica  767 34.30% 65.70% 0.00% 0.00% NA
Tropical Japonica  504 18.30% 81.70% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 53.90% 0.41% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210995463 A -> DEL N N silent_mutation Average:78.884; most accessible tissue: Callus, score: 95.838 N N N N
vg1210995463 A -> G LOC_Os12g18950.1 upstream_gene_variant ; 424.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Callus, score: 95.838 N N N N
vg1210995463 A -> G LOC_Os12g18930.1 downstream_gene_variant ; 4512.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Callus, score: 95.838 N N N N
vg1210995463 A -> G LOC_Os12g18940.1 downstream_gene_variant ; 4008.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Callus, score: 95.838 N N N N
vg1210995463 A -> G LOC_Os12g18960.1 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Callus, score: 95.838 N N N N
vg1210995463 A -> G LOC_Os12g18960.2 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Callus, score: 95.838 N N N N
vg1210995463 A -> G LOC_Os12g18950-LOC_Os12g18960 intergenic_region ; MODIFIER silent_mutation Average:78.884; most accessible tissue: Callus, score: 95.838 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1210995463 A G 0.0 0.0 -0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210995463 NA 3.57E-25 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 8.33E-22 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 8.11E-07 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 3.62E-06 1.11E-26 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 7.22E-07 2.69E-20 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 8.53E-06 8.53E-06 mr1041 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 3.04E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 3.54E-22 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 3.70E-24 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 9.34E-18 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 1.91E-19 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 2.14E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 6.14E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 2.85E-07 1.78E-26 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 2.67E-06 NA mr1293 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 1.76E-06 mr1293 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 7.30E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 2.01E-21 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 5.98E-10 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 1.11E-19 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 4.11E-20 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 2.28E-17 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 5.76E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 1.10E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 6.41E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 5.56E-06 5.54E-06 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 6.89E-07 1.47E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 8.05E-06 mr1019_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 1.24E-09 1.40E-32 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 1.90E-08 2.26E-23 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 4.12E-06 1.66E-25 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 3.09E-08 6.76E-27 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 7.61E-06 7.03E-25 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 2.37E-24 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 1.67E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 1.44E-07 1.35E-27 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 2.05E-06 4.06E-16 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 4.02E-24 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 1.46E-06 7.46E-17 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 3.52E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 2.25E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210995463 NA 6.59E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251