\
| Variant ID: vg1210984536 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10984536 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )
ACAAAGGAATCAACTGAGAATCAAATTAAACAAATGAATCAAATGAATCGCAGGCTCGATCATTTGCAGCAATGGCAGATTTGGACTTGTTGGATCAATC[G/A]
ATCTCAAGGCATCCACGCACTCGTCCACACGACAGGCTGCTCCTTCCATGCAAGGAATGCTCCGGCAGCGGCAGCGTTGTCCATGTCACTGCCGTAGTCC
GGACTACGGCAGTGACATGGACAACGCTGCCGCTGCCGGAGCATTCCTTGCATGGAAGGAGCAGCCTGTCGTGTGGACGAGTGCGTGGATGCCTTGAGAT[C/T]
GATTGATCCAACAAGTCCAAATCTGCCATTGCTGCAAATGATCGAGCCTGCGATTCATTTGATTCATTTGTTTAATTTGATTCTCAGTTGATTCCTTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 9.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 83.30% | 16.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 55.10% | 44.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210984536 | G -> A | LOC_Os12g18930.1 | synonymous_variant ; p.Ser10Ser; LOW | synonymous_codon | Average:64.408; most accessible tissue: Minghui63 young leaf, score: 77.654 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210984536 | NA | 7.80E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | NA | 5.28E-06 | mr1164_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | NA | 6.31E-07 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | NA | 2.59E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | NA | 5.81E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | 5.33E-07 | NA | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | 2.92E-07 | 1.33E-09 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | 1.28E-06 | NA | mr1361_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | 7.80E-07 | 6.06E-10 | mr1361_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | NA | 4.40E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210984536 | 5.54E-06 | 5.53E-06 | mr1853_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |