Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210856629:

Variant ID: vg1210856629 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10856629
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTTGCCTGGGCTGCTTTGCGCATACTTGCCACACATTTCCTCATGTCAAACATTAACATCCATCATCTATCTATCTATCTATTATATACTAAAAGTC[T/C]
ATTAAACTTCCTCAAAACGCTCTTAAGCCGACACGTGGCGCTGTAATAAATTAGAGAAAATCCTAGAAAATCAGAGAAAAAAGCAAAACATCCATCCGTT

Reverse complement sequence

AACGGATGGATGTTTTGCTTTTTTCTCTGATTTTCTAGGATTTTCTCTAATTTATTACAGCGCCACGTGTCGGCTTAAGAGCGTTTTGAGGAAGTTTAAT[A/G]
GACTTTTAGTATATAATAGATAGATAGATAGATGATGGATGTTAATGTTTGACATGAGGAAATGTGTGGCAAGTATGCGCAAAGCAGCCCAGGCAACGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.80% 17.10% 16.46% 40.63% NA
All Indica  2759 4.00% 23.90% 20.88% 51.29% NA
All Japonica  1512 68.60% 0.90% 7.74% 22.75% NA
Aus  269 10.80% 44.20% 17.84% 27.14% NA
Indica I  595 2.40% 45.50% 5.21% 46.89% NA
Indica II  465 11.80% 21.90% 22.80% 43.44% NA
Indica III  913 1.20% 11.80% 30.45% 56.52% NA
Indica Intermediate  786 3.70% 22.60% 20.48% 53.18% NA
Temperate Japonica  767 72.80% 0.70% 3.26% 23.34% NA
Tropical Japonica  504 69.00% 1.00% 10.52% 19.44% NA
Japonica Intermediate  241 54.40% 1.70% 16.18% 27.80% NA
VI/Aromatic  96 11.50% 7.30% 21.88% 59.38% NA
Intermediate  90 38.90% 8.90% 17.78% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210856629 T -> C LOC_Os12g18760.2 downstream_gene_variant ; 301.0bp to feature; MODIFIER silent_mutation Average:67.022; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg1210856629 T -> C LOC_Os12g18760-LOC_Os12g18770 intergenic_region ; MODIFIER silent_mutation Average:67.022; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg1210856629 T -> DEL N N silent_mutation Average:67.022; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210856629 1.06E-08 3.82E-37 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.65E-07 2.51E-31 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 2.48E-07 1.07E-09 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.26E-11 1.82E-37 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 8.50E-14 2.70E-33 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.35E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 3.11E-10 2.70E-38 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.93E-09 1.11E-38 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.17E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.92E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 6.58E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.77E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.28E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 4.36E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 2.45E-10 1.91E-28 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.18E-12 8.10E-34 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 5.21E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.43E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 6.02E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 6.23E-13 5.10E-38 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.39E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 9.06E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.52E-11 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.91E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 2.20E-10 8.39E-37 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.07E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.44E-10 1.53E-19 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.79E-08 4.61E-33 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 9.45E-15 4.16E-35 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.40E-19 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 6.29E-07 mr1587 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 6.26E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.56E-06 mr1780 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 6.85E-06 mr1792 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 6.40E-10 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 3.79E-06 6.07E-37 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.03E-08 6.87E-28 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.03E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.47E-06 1.61E-36 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.52E-08 1.03E-35 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.80E-09 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.18E-10 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.38E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 5.75E-29 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.49E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.89E-12 5.07E-40 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.65E-10 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 4.28E-07 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.31E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.19E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.51E-15 mr1301_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.12E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 8.01E-09 1.74E-38 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 5.56E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.89E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 5.96E-08 1.41E-19 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 2.46E-07 3.94E-32 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 3.01E-15 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 2.21E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 5.66E-08 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 5.82E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.25E-10 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 8.33E-11 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.36E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 9.58E-08 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 7.53E-06 1.54E-09 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 1.77E-06 6.37E-12 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 7.37E-06 4.24E-10 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 1.16E-10 mr1805_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210856629 NA 8.58E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251