\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210818720:

Variant ID: vg1210818720 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10818720
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GAACTTAAAAACCGACTCAAACATGGATCTGTATTTCCAAAAGAGAACGAACATAAAAACCATCTTAAATACGAATGACGTACCATTAAAACATGTTCAA[A/T]
TTTTATAATATAATAGTACATATTCTAGAAATGAATTATTAATTGATTTTAATCCATGAAAGAAAATCGGAGTGTGACATCCGGTCACCAGATCAAATCG

Reverse complement sequence

CGATTTGATCTGGTGACCGGATGTCACACTCCGATTTTCTTTCATGGATTAAAATCAATTAATAATTCATTTCTAGAATATGTACTATTATATTATAAAA[T/A]
TTGAACATGTTTTAATGGTACGTCATTCGTATTTAAGATGGTTTTTATGTTCGTTCTCTTTTGGAAATACAGATCCATGTTTGAGTCGGTTTTTAAGTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 38.10% 0.32% 3.17% NA
All Indica  2759 79.00% 20.60% 0.04% 0.33% NA
All Japonica  1512 21.60% 68.50% 0.79% 9.13% NA
Aus  269 48.30% 51.70% 0.00% 0.00% NA
Indica I  595 52.10% 47.20% 0.00% 0.67% NA
Indica II  465 78.10% 21.90% 0.00% 0.00% NA
Indica III  913 95.60% 4.20% 0.00% 0.22% NA
Indica Intermediate  786 80.70% 18.80% 0.13% 0.38% NA
Temperate Japonica  767 10.80% 72.80% 1.56% 14.86% NA
Tropical Japonica  504 31.00% 69.00% 0.00% 0.00% NA
Japonica Intermediate  241 36.10% 53.90% 0.00% 9.96% NA
VI/Aromatic  96 81.20% 16.70% 1.04% 1.04% NA
Intermediate  90 51.10% 45.60% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210818720 A -> DEL N N silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg1210818720 A -> T LOC_Os12g18729.1 upstream_gene_variant ; 3814.0bp to feature; MODIFIER silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg1210818720 A -> T LOC_Os12g18729.2 upstream_gene_variant ; 3814.0bp to feature; MODIFIER silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg1210818720 A -> T LOC_Os12g18729.3 upstream_gene_variant ; 3814.0bp to feature; MODIFIER silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg1210818720 A -> T LOC_Os12g18729.4 upstream_gene_variant ; 3814.0bp to feature; MODIFIER silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg1210818720 A -> T LOC_Os12g18729.5 upstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg1210818720 A -> T LOC_Os12g18710.1 downstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N
vg1210818720 A -> T LOC_Os12g18710-LOC_Os12g18729 intergenic_region ; MODIFIER silent_mutation Average:64.988; most accessible tissue: Minghui63 flower, score: 89.852 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1210818720 A T 0.02 0.01 0.01 0.04 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210818720 NA 2.79E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 6.24E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 8.66E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 5.88E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 2.19E-07 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.76E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.14E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 9.08E-07 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 7.22E-06 mr1175_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 3.30E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 2.96E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.44E-10 mr1358_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 5.76E-07 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 2.21E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 2.83E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 5.48E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 2.15E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 2.18E-06 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 7.73E-06 7.72E-06 mr1487_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.93E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.52E-10 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 3.90E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 2.84E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 8.16E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.10E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 5.45E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.67E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210818720 NA 1.82E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251