\
| Variant ID: vg1210798384 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10798384 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 89. )
ATGACTGGATTCAAATCCTAAATAAAAAATGTTCAACCATGAACAATTCCTAGATTCAACAATTCAAATAAACTAAATCCTAAATCCTAAATCAAATGAA[C/T]
CATCCTGGATTCAACTATGACCTAAATACTAAAATCCTAATCCAACCAAATTACCAAAATGTTTCTAACCTTCCACCTTTGTTTGGGTCTGGGCGTCTAG
CTAGACGCCCAGACCCAAACAAAGGTGGAAGGTTAGAAACATTTTGGTAATTTGGTTGGATTAGGATTTTAGTATTTAGGTCATAGTTGAATCCAGGATG[G/A]
TTCATTTGATTTAGGATTTAGGATTTAGTTTATTTGAATTGTTGAATCTAGGAATTGTTCATGGTTGAACATTTTTTATTTAGGATTTGAATCCAGTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 14.00% | 0.63% | 3.28% | NA |
| All Indica | 2759 | 85.00% | 13.90% | 0.83% | 0.22% | NA |
| All Japonica | 1512 | 73.10% | 16.70% | 0.40% | 9.79% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.10% | 9.90% | 0.34% | 0.67% | NA |
| Indica II | 465 | 92.00% | 7.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 81.40% | 17.70% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 82.10% | 16.30% | 1.40% | 0.25% | NA |
| Temperate Japonica | 767 | 79.70% | 4.00% | 0.26% | 16.04% | NA |
| Tropical Japonica | 504 | 71.40% | 28.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.60% | 33.20% | 0.83% | 10.37% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210798384 | C -> DEL | N | N | silent_mutation | Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 | N | N | N | N |
| vg1210798384 | C -> T | LOC_Os12g18690.1 | upstream_gene_variant ; 1287.0bp to feature; MODIFIER | silent_mutation | Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 | N | N | N | N |
| vg1210798384 | C -> T | LOC_Os12g18680.1 | downstream_gene_variant ; 4110.0bp to feature; MODIFIER | silent_mutation | Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 | N | N | N | N |
| vg1210798384 | C -> T | LOC_Os12g18680-LOC_Os12g18690 | intergenic_region ; MODIFIER | silent_mutation | Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210798384 | NA | 4.03E-06 | mr1095 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 4.43E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 1.35E-09 | mr1177 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 8.54E-08 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 1.76E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 8.70E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 1.19E-07 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 7.71E-06 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | 5.90E-06 | 5.90E-06 | mr1663 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 2.02E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210798384 | NA | 2.67E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |