Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210798384:

Variant ID: vg1210798384 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10798384
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

ATGACTGGATTCAAATCCTAAATAAAAAATGTTCAACCATGAACAATTCCTAGATTCAACAATTCAAATAAACTAAATCCTAAATCCTAAATCAAATGAA[C/T]
CATCCTGGATTCAACTATGACCTAAATACTAAAATCCTAATCCAACCAAATTACCAAAATGTTTCTAACCTTCCACCTTTGTTTGGGTCTGGGCGTCTAG

Reverse complement sequence

CTAGACGCCCAGACCCAAACAAAGGTGGAAGGTTAGAAACATTTTGGTAATTTGGTTGGATTAGGATTTTAGTATTTAGGTCATAGTTGAATCCAGGATG[G/A]
TTCATTTGATTTAGGATTTAGGATTTAGTTTATTTGAATTGTTGAATCTAGGAATTGTTCATGGTTGAACATTTTTTATTTAGGATTTGAATCCAGTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	14.00%	0.63%	3.28%	NA
All Indica	2759	85.00%	13.90%	0.83%	0.22%	NA
All Japonica	1512	73.10%	16.70%	0.40%	9.79%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	89.10%	9.90%	0.34%	0.67%	NA
Indica II	465	92.00%	7.50%	0.43%	0.00%	NA
Indica III	913	81.40%	17.70%	0.88%	0.00%	NA
Indica Intermediate	786	82.10%	16.30%	1.40%	0.25%	NA
Temperate Japonica	767	79.70%	4.00%	0.26%	16.04%	NA
Tropical Japonica	504	71.40%	28.20%	0.40%	0.00%	NA
Japonica Intermediate	241	55.60%	33.20%	0.83%	10.37%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210798384	C -> DEL	N	N	silent_mutation	Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408	N	N	N	N
vg1210798384	C -> T	LOC_Os12g18690.1	upstream_gene_variant ; 1287.0bp to feature; MODIFIER	silent_mutation	Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408	N	N	N	N
vg1210798384	C -> T	LOC_Os12g18680.1	downstream_gene_variant ; 4110.0bp to feature; MODIFIER	silent_mutation	Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408	N	N	N	N
vg1210798384	C -> T	LOC_Os12g18680-LOC_Os12g18690	intergenic_region ; MODIFIER	silent_mutation	Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210798384	NA	4.03E-06	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	4.43E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	1.35E-09	mr1177	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	8.54E-08	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	1.76E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	8.70E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	1.19E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	7.71E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	5.90E-06	5.90E-06	mr1663	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	2.02E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384	NA	2.67E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251