\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210798384:

Variant ID: vg1210798384 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10798384
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATGACTGGATTCAAATCCTAAATAAAAAATGTTCAACCATGAACAATTCCTAGATTCAACAATTCAAATAAACTAAATCCTAAATCCTAAATCAAATGAA[C/T]
CATCCTGGATTCAACTATGACCTAAATACTAAAATCCTAATCCAACCAAATTACCAAAATGTTTCTAACCTTCCACCTTTGTTTGGGTCTGGGCGTCTAG

Reverse complement sequence

CTAGACGCCCAGACCCAAACAAAGGTGGAAGGTTAGAAACATTTTGGTAATTTGGTTGGATTAGGATTTTAGTATTTAGGTCATAGTTGAATCCAGGATG[G/A]
TTCATTTGATTTAGGATTTAGGATTTAGTTTATTTGAATTGTTGAATCTAGGAATTGTTCATGGTTGAACATTTTTTATTTAGGATTTGAATCCAGTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 14.00% 0.63% 3.28% NA
All Indica  2759 85.00% 13.90% 0.83% 0.22% NA
All Japonica  1512 73.10% 16.70% 0.40% 9.79% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 89.10% 9.90% 0.34% 0.67% NA
Indica II  465 92.00% 7.50% 0.43% 0.00% NA
Indica III  913 81.40% 17.70% 0.88% 0.00% NA
Indica Intermediate  786 82.10% 16.30% 1.40% 0.25% NA
Temperate Japonica  767 79.70% 4.00% 0.26% 16.04% NA
Tropical Japonica  504 71.40% 28.20% 0.40% 0.00% NA
Japonica Intermediate  241 55.60% 33.20% 0.83% 10.37% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210798384 C -> DEL N N silent_mutation Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 N N N N
vg1210798384 C -> T LOC_Os12g18690.1 upstream_gene_variant ; 1287.0bp to feature; MODIFIER silent_mutation Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 N N N N
vg1210798384 C -> T LOC_Os12g18680.1 downstream_gene_variant ; 4110.0bp to feature; MODIFIER silent_mutation Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 N N N N
vg1210798384 C -> T LOC_Os12g18680-LOC_Os12g18690 intergenic_region ; MODIFIER silent_mutation Average:73.486; most accessible tissue: Minghui63 panicle, score: 90.408 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210798384 NA 4.03E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 4.43E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 1.35E-09 mr1177 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 8.54E-08 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 1.76E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 8.70E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 1.19E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 7.71E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 5.90E-06 5.90E-06 mr1663 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 2.02E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210798384 NA 2.67E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251