\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210774599:

Variant ID: vg1210774599 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10774599
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTGTTATTTTCTAAGAGTATTGGTCAGTAATGTCTGTCTTCCGTTTTGTCAAAAGATTGAGGGTCTATTAACCCTCTACTGTGAATTTCATTTTCTT[T/A]
TAGCTCTTCACCTATCTGCTCATCCTTACTCACAATGATAATCTTCAGTGAAAAGATAAACACATTTGCTCATATACCTTTTATAACTTTGCATTTCTCT

Reverse complement sequence

AGAGAAATGCAAAGTTATAAAAGGTATATGAGCAAATGTGTTTATCTTTTCACTGAAGATTATCATTGTGAGTAAGGATGAGCAGATAGGTGAAGAGCTA[A/T]
AAGAAAATGAAATTCACAGTAGAGGGTTAATAGACCCTCAATCTTTTGACAAAACGGAAGACAGACATTACTGACCAATACTCTTAGAAAATAACAATAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 3.50% 0.00% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 89.70% 10.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 83.10% 16.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210774599 T -> A LOC_Os12g18650.1 intron_variant ; MODIFIER silent_mutation Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg1210774599 T -> A LOC_Os12g18650.7 intron_variant ; MODIFIER silent_mutation Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg1210774599 T -> A LOC_Os12g18650.2 intron_variant ; MODIFIER silent_mutation Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg1210774599 T -> A LOC_Os12g18650.6 intron_variant ; MODIFIER silent_mutation Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg1210774599 T -> A LOC_Os12g18650.3 intron_variant ; MODIFIER silent_mutation Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg1210774599 T -> A LOC_Os12g18650.5 intron_variant ; MODIFIER silent_mutation Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N
vg1210774599 T -> A LOC_Os12g18650.4 intron_variant ; MODIFIER silent_mutation Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210774599 1.05E-06 NA mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210774599 NA 3.65E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251