\
| Variant ID: vg1210774599 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10774599 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 236. )
CTATTGTTATTTTCTAAGAGTATTGGTCAGTAATGTCTGTCTTCCGTTTTGTCAAAAGATTGAGGGTCTATTAACCCTCTACTGTGAATTTCATTTTCTT[T/A]
TAGCTCTTCACCTATCTGCTCATCCTTACTCACAATGATAATCTTCAGTGAAAAGATAAACACATTTGCTCATATACCTTTTATAACTTTGCATTTCTCT
AGAGAAATGCAAAGTTATAAAAGGTATATGAGCAAATGTGTTTATCTTTTCACTGAAGATTATCATTGTGAGTAAGGATGAGCAGATAGGTGAAGAGCTA[A/T]
AAGAAAATGAAATTCACAGTAGAGGGTTAATAGACCCTCAATCTTTTGACAAAACGGAAGACAGACATTACTGACCAATACTCTTAGAAAATAACAATAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 83.10% | 16.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210774599 | T -> A | LOC_Os12g18650.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 | N | N | N | N |
| vg1210774599 | T -> A | LOC_Os12g18650.7 | intron_variant ; MODIFIER | silent_mutation | Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 | N | N | N | N |
| vg1210774599 | T -> A | LOC_Os12g18650.2 | intron_variant ; MODIFIER | silent_mutation | Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 | N | N | N | N |
| vg1210774599 | T -> A | LOC_Os12g18650.6 | intron_variant ; MODIFIER | silent_mutation | Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 | N | N | N | N |
| vg1210774599 | T -> A | LOC_Os12g18650.3 | intron_variant ; MODIFIER | silent_mutation | Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 | N | N | N | N |
| vg1210774599 | T -> A | LOC_Os12g18650.5 | intron_variant ; MODIFIER | silent_mutation | Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 | N | N | N | N |
| vg1210774599 | T -> A | LOC_Os12g18650.4 | intron_variant ; MODIFIER | silent_mutation | Average:61.795; most accessible tissue: Zhenshan97 flower, score: 75.883 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210774599 | 1.05E-06 | NA | mr1164_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210774599 | NA | 3.65E-07 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |