Variant ID: vg1210706721 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 10706721 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTTTCCTTTTTAAAAAAAACGACACCCTATAAAACAAGCTGAGACGAGAGAGTCGTTTTTTCTCTTTTAGTGCATGGGGCGGGCGCCGAGATAAATTAC[C/T]
GCGTGAGAGGTGAGGGGGGTGAGTGGATAAGGACGCCCCCCCCCCCCCCTCTTCACCTCCTCTCACGGTCTCACCCTCTACCTCTCACTCCCTCTTGTCC
GGACAAGAGGGAGTGAGAGGTAGAGGGTGAGACCGTGAGAGGAGGTGAAGAGGGGGGGGGGGGGGCGTCCTTATCCACTCACCCCCCTCACCTCTCACGC[G/A]
GTAATTTATCTCGGCGCCCGCCCCATGCACTAAAAGAGAAAAAACGACTCTCTCGTCTCAGCTTGTTTTATAGGGTGTCGTTTTTTTTAAAAAGGAAACT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1210706721 | C -> T | LOC_Os12g18510.1 | upstream_gene_variant ; 2702.0bp to feature; MODIFIER | silent_mutation | Average:62.67; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
vg1210706721 | C -> T | LOC_Os12g18520.1 | upstream_gene_variant ; 3243.0bp to feature; MODIFIER | silent_mutation | Average:62.67; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
vg1210706721 | C -> T | LOC_Os12g18510-LOC_Os12g18520 | intergenic_region ; MODIFIER | silent_mutation | Average:62.67; most accessible tissue: Zhenshan97 young leaf, score: 79.507 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1210706721 | NA | 4.06E-07 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | NA | 3.49E-08 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | NA | 2.56E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | 8.56E-07 | 8.56E-07 | mr1587_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | NA | 6.29E-07 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | NA | 1.23E-06 | mr1803_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | NA | 9.68E-09 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | NA | 7.76E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210706721 | NA | 4.08E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |