\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210687991:

Variant ID: vg1210687991 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10687991
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCATACACCCCTTGCACCTCTCTCACACTCACTTGAGCTTTGTGTTCATCCATCTAGTGTGGTAGAGGGTTGATTAGCCAAGAGTCAAGTGCATTTGC[T/C]
TCCATTGTAGAGCTAGTGTGGCACTTGATCATCTCCACGCCGGGTCATTGCTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGACTTGTGGAGAAGTTG

Reverse complement sequence

CAACTTCTCCACAAGTCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGCAATGACCCGGCGTGGAGATGATCAAGTGCCACACTAGCTCTACAATGGA[A/G]
GCAAATGCACTTGACTCTTGGCTAATCAACCCTCTACCACACTAGATGGATGAACACAAAGCTCAAGTGAGTGTGAGAGAGGTGCAAGGGGTGTATGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.20% 0.10% 0.72% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 97.60% 0.30% 2.05% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 95.40% 0.70% 3.91% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210687991 T -> C LOC_Os12g18470.1 downstream_gene_variant ; 2996.0bp to feature; MODIFIER silent_mutation Average:56.058; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg1210687991 T -> C LOC_Os12g18490.1 downstream_gene_variant ; 3918.0bp to feature; MODIFIER silent_mutation Average:56.058; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N
vg1210687991 T -> C LOC_Os12g18479.1 intron_variant ; MODIFIER silent_mutation Average:56.058; most accessible tissue: Minghui63 young leaf, score: 74.514 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210687991 NA 1.14E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210687991 8.58E-08 6.41E-10 mr1829 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210687991 NA 3.56E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210687991 3.99E-06 3.99E-06 mr1587_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210687991 3.63E-06 8.97E-10 mr1829_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210687991 NA 4.74E-07 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210687991 1.78E-06 4.87E-09 mr1902_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251