Variant ID: vg1210687991 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 10687991 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 304. )
TTGCATACACCCCTTGCACCTCTCTCACACTCACTTGAGCTTTGTGTTCATCCATCTAGTGTGGTAGAGGGTTGATTAGCCAAGAGTCAAGTGCATTTGC[T/C]
TCCATTGTAGAGCTAGTGTGGCACTTGATCATCTCCACGCCGGGTCATTGCTTGTTACTCTTGGAGGTTGCCGCCTCCTAGACGACTTGTGGAGAAGTTG
CAACTTCTCCACAAGTCGTCTAGGAGGCGGCAACCTCCAAGAGTAACAAGCAATGACCCGGCGTGGAGATGATCAAGTGCCACACTAGCTCTACAATGGA[A/G]
GCAAATGCACTTGACTCTTGGCTAATCAACCCTCTACCACACTAGATGGATGAACACAAAGCTCAAGTGAGTGTGAGAGAGGTGCAAGGGGTGTATGCAA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 99.20% | 0.10% | 0.72% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 97.60% | 0.30% | 2.05% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 95.40% | 0.70% | 3.91% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1210687991 | T -> C | LOC_Os12g18470.1 | downstream_gene_variant ; 2996.0bp to feature; MODIFIER | silent_mutation | Average:56.058; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
vg1210687991 | T -> C | LOC_Os12g18490.1 | downstream_gene_variant ; 3918.0bp to feature; MODIFIER | silent_mutation | Average:56.058; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
vg1210687991 | T -> C | LOC_Os12g18479.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.058; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1210687991 | NA | 1.14E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210687991 | 8.58E-08 | 6.41E-10 | mr1829 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210687991 | NA | 3.56E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210687991 | 3.99E-06 | 3.99E-06 | mr1587_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210687991 | 3.63E-06 | 8.97E-10 | mr1829_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210687991 | NA | 4.74E-07 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1210687991 | 1.78E-06 | 4.87E-09 | mr1902_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |