\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210641830:

Variant ID: vg1210641830 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10641830
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTTTCTTAGTAGCCTTGTTGAGTTTCCTATAGTCAATACACATCCTCCATCACGTGACGGTTTGTTGTGGGCAACTCGTTGTTCGAGTTTTCAAGACC[A/G]
TCATGCCTCCCTTCTTAGGCACTACTTGGACAGGGCTAACTGTTGGTATTTCTTACGATCACAAATAGAATCCGCAAGCGCACGGATATACTGATGTAGT

Reverse complement sequence

ACTACATCAGTATATCCGTGCGCTTGCGGATTCTATTTGTGATCGTAAGAAATACCAACAGTTAGCCCTGTCCAAGTAGTGCCTAAGAAGGGAGGCATGA[T/C]
GGTCTTGAAAACTCGAACAACGAGTTGCCCACAACAAACCGTCACGTGATGGAGGATGTGTATTGACTATAGGAAACTCAACAAGGCTACTAAGAAAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 47.10% 0.38% 0.02% NA
All Indica  2759 70.60% 28.70% 0.62% 0.04% NA
All Japonica  1512 23.40% 76.60% 0.00% 0.00% NA
Aus  269 41.30% 58.40% 0.37% 0.00% NA
Indica I  595 95.50% 4.00% 0.50% 0.00% NA
Indica II  465 50.80% 48.40% 0.65% 0.22% NA
Indica III  913 67.30% 32.00% 0.77% 0.00% NA
Indica Intermediate  786 67.60% 31.90% 0.51% 0.00% NA
Temperate Japonica  767 10.70% 89.30% 0.00% 0.00% NA
Tropical Japonica  504 37.30% 62.70% 0.00% 0.00% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210641830 A -> DEL N N silent_mutation Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1210641830 A -> G LOC_Os12g18390.1 upstream_gene_variant ; 758.0bp to feature; MODIFIER silent_mutation Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1210641830 A -> G LOC_Os12g18400.1 downstream_gene_variant ; 2287.0bp to feature; MODIFIER silent_mutation Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1210641830 A -> G LOC_Os12g18390-LOC_Os12g18400 intergenic_region ; MODIFIER silent_mutation Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210641830 NA 2.12E-27 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830 NA 5.79E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830 NA 5.65E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830 NA 6.95E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830 NA 3.86E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830 8.71E-07 NA mr1178_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830 NA 1.32E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251