Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210641830:

Variant ID: vg1210641830 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10641830
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTTTCTTAGTAGCCTTGTTGAGTTTCCTATAGTCAATACACATCCTCCATCACGTGACGGTTTGTTGTGGGCAACTCGTTGTTCGAGTTTTCAAGACC[A/G]
TCATGCCTCCCTTCTTAGGCACTACTTGGACAGGGCTAACTGTTGGTATTTCTTACGATCACAAATAGAATCCGCAAGCGCACGGATATACTGATGTAGT

Reverse complement sequence

ACTACATCAGTATATCCGTGCGCTTGCGGATTCTATTTGTGATCGTAAGAAATACCAACAGTTAGCCCTGTCCAAGTAGTGCCTAAGAAGGGAGGCATGA[T/C]
GGTCTTGAAAACTCGAACAACGAGTTGCCCACAACAAACCGTCACGTGATGGAGGATGTGTATTGACTATAGGAAACTCAACAAGGCTACTAAGAAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	47.10%	0.38%	0.02%	NA
All Indica	2759	70.60%	28.70%	0.62%	0.04%	NA
All Japonica	1512	23.40%	76.60%	0.00%	0.00%	NA
Aus	269	41.30%	58.40%	0.37%	0.00%	NA
Indica I	595	95.50%	4.00%	0.50%	0.00%	NA
Indica II	465	50.80%	48.40%	0.65%	0.22%	NA
Indica III	913	67.30%	32.00%	0.77%	0.00%	NA
Indica Intermediate	786	67.60%	31.90%	0.51%	0.00%	NA
Temperate Japonica	767	10.70%	89.30%	0.00%	0.00%	NA
Tropical Japonica	504	37.30%	62.70%	0.00%	0.00%	NA
Japonica Intermediate	241	34.90%	65.10%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	42.20%	57.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210641830	A -> DEL	N	N	silent_mutation	Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg1210641830	A -> G	LOC_Os12g18390.1	upstream_gene_variant ; 758.0bp to feature; MODIFIER	silent_mutation	Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg1210641830	A -> G	LOC_Os12g18400.1	downstream_gene_variant ; 2287.0bp to feature; MODIFIER	silent_mutation	Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg1210641830	A -> G	LOC_Os12g18390-LOC_Os12g18400	intergenic_region ; MODIFIER	silent_mutation	Average:58.487; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210641830	NA	2.12E-27	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830	NA	5.79E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830	NA	5.65E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830	NA	6.95E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830	NA	3.86E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830	8.71E-07	NA	mr1178_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210641830	NA	1.32E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251