\
| Variant ID: vg1210581967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10581967 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )
TTCCACATGCCGCATCTCAATTACCTTCCCAAAGGTAATTGCCCAAGCATATAGTATTTGATAAAATATGAGCATGCATGAATCTAAAATAGCATTTCTA[A/T]
GCAATTGTCATAGTTGACTAGGGGCTCGTACGTATCTATGGTTACAAAGATTTAAAGGTGAACAATAATCAAGGCATGGCATATTTCACAAGTGGGATGT
ACATCCCACTTGTGAAATATGCCATGCCTTGATTATTGTTCACCTTTAAATCTTTGTAACCATAGATACGTACGAGCCCCTAGTCAACTATGACAATTGC[T/A]
TAGAAATGCTATTTTAGATTCATGCATGCTCATATTTTATCAAATACTATATGCTTGGGCAATTACCTTTGGGAAGGTAATTGAGATGCGGCATGTGGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 6.90% | 0.93% | 9.01% | NA |
| All Indica | 2759 | 76.30% | 7.60% | 1.38% | 14.75% | NA |
| All Japonica | 1512 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Aus | 269 | 61.70% | 32.70% | 1.12% | 4.46% | NA |
| Indica I | 595 | 97.10% | 1.00% | 0.17% | 1.68% | NA |
| Indica II | 465 | 64.10% | 11.20% | 1.72% | 23.01% | NA |
| Indica III | 913 | 70.10% | 8.30% | 1.86% | 19.72% | NA |
| Indica Intermediate | 786 | 74.90% | 9.50% | 1.53% | 13.99% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 81.20% | 16.70% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 12.20% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210581967 | A -> DEL | N | N | silent_mutation | Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1210581967 | A -> T | LOC_Os12g18320.1 | upstream_gene_variant ; 3224.0bp to feature; MODIFIER | silent_mutation | Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1210581967 | A -> T | LOC_Os12g18330.1 | upstream_gene_variant ; 1652.0bp to feature; MODIFIER | silent_mutation | Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1210581967 | A -> T | LOC_Os12g18340.1 | downstream_gene_variant ; 4020.0bp to feature; MODIFIER | silent_mutation | Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg1210581967 | A -> T | LOC_Os12g18330-LOC_Os12g18340 | intergenic_region ; MODIFIER | silent_mutation | Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210581967 | NA | 1.42E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 5.40E-07 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 9.67E-07 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 3.64E-07 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | 4.19E-06 | 9.45E-09 | mr1917 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 1.35E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 4.56E-07 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 7.88E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 2.38E-06 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210581967 | NA | 5.69E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |