\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210581967:

Variant ID: vg1210581967 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10581967
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCACATGCCGCATCTCAATTACCTTCCCAAAGGTAATTGCCCAAGCATATAGTATTTGATAAAATATGAGCATGCATGAATCTAAAATAGCATTTCTA[A/T]
GCAATTGTCATAGTTGACTAGGGGCTCGTACGTATCTATGGTTACAAAGATTTAAAGGTGAACAATAATCAAGGCATGGCATATTTCACAAGTGGGATGT

Reverse complement sequence

ACATCCCACTTGTGAAATATGCCATGCCTTGATTATTGTTCACCTTTAAATCTTTGTAACCATAGATACGTACGAGCCCCTAGTCAACTATGACAATTGC[T/A]
TAGAAATGCTATTTTAGATTCATGCATGCTCATATTTTATCAAATACTATATGCTTGGGCAATTACCTTTGGGAAGGTAATTGAGATGCGGCATGTGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 6.90% 0.93% 9.01% NA
All Indica  2759 76.30% 7.60% 1.38% 14.75% NA
All Japonica  1512 99.60% 0.20% 0.00% 0.20% NA
Aus  269 61.70% 32.70% 1.12% 4.46% NA
Indica I  595 97.10% 1.00% 0.17% 1.68% NA
Indica II  465 64.10% 11.20% 1.72% 23.01% NA
Indica III  913 70.10% 8.30% 1.86% 19.72% NA
Indica Intermediate  786 74.90% 9.50% 1.53% 13.99% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 81.20% 16.70% 2.08% 0.00% NA
Intermediate  90 82.20% 12.20% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210581967 A -> DEL N N silent_mutation Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg1210581967 A -> T LOC_Os12g18320.1 upstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg1210581967 A -> T LOC_Os12g18330.1 upstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg1210581967 A -> T LOC_Os12g18340.1 downstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg1210581967 A -> T LOC_Os12g18330-LOC_Os12g18340 intergenic_region ; MODIFIER silent_mutation Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210581967 NA 1.42E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 5.40E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 9.67E-07 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 3.64E-07 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 4.19E-06 9.45E-09 mr1917 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 1.35E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 4.56E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 7.88E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 2.38E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967 NA 5.69E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251