Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210581967:

Variant ID: vg1210581967 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10581967
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCACATGCCGCATCTCAATTACCTTCCCAAAGGTAATTGCCCAAGCATATAGTATTTGATAAAATATGAGCATGCATGAATCTAAAATAGCATTTCTA[A/T]
GCAATTGTCATAGTTGACTAGGGGCTCGTACGTATCTATGGTTACAAAGATTTAAAGGTGAACAATAATCAAGGCATGGCATATTTCACAAGTGGGATGT

Reverse complement sequence

ACATCCCACTTGTGAAATATGCCATGCCTTGATTATTGTTCACCTTTAAATCTTTGTAACCATAGATACGTACGAGCCCCTAGTCAACTATGACAATTGC[T/A]
TAGAAATGCTATTTTAGATTCATGCATGCTCATATTTTATCAAATACTATATGCTTGGGCAATTACCTTTGGGAAGGTAATTGAGATGCGGCATGTGGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	6.90%	0.93%	9.01%	NA
All Indica	2759	76.30%	7.60%	1.38%	14.75%	NA
All Japonica	1512	99.60%	0.20%	0.00%	0.20%	NA
Aus	269	61.70%	32.70%	1.12%	4.46%	NA
Indica I	595	97.10%	1.00%	0.17%	1.68%	NA
Indica II	465	64.10%	11.20%	1.72%	23.01%	NA
Indica III	913	70.10%	8.30%	1.86%	19.72%	NA
Indica Intermediate	786	74.90%	9.50%	1.53%	13.99%	NA
Temperate Japonica	767	99.60%	0.10%	0.00%	0.26%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	81.20%	16.70%	2.08%	0.00%	NA
Intermediate	90	82.20%	12.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210581967	A -> DEL	N	N	silent_mutation	Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg1210581967	A -> T	LOC_Os12g18320.1	upstream_gene_variant ; 3224.0bp to feature; MODIFIER	silent_mutation	Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg1210581967	A -> T	LOC_Os12g18330.1	upstream_gene_variant ; 1652.0bp to feature; MODIFIER	silent_mutation	Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg1210581967	A -> T	LOC_Os12g18340.1	downstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg1210581967	A -> T	LOC_Os12g18330-LOC_Os12g18340	intergenic_region ; MODIFIER	silent_mutation	Average:36.044; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210581967	NA	1.42E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	5.40E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	9.67E-07	mr1117	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	3.64E-07	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	4.19E-06	9.45E-09	mr1917	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	1.35E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	4.56E-07	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	7.88E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	2.38E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210581967	NA	5.69E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251