\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210564472:

Variant ID: vg1210564472 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10564472
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.04, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTAAAATTATGATCTACATGTTTGTTTACTTTTTATGTATTATTTCTTTGGTTTTTATTAGTCTTTTTCTTCATTTTGCGTGATAGTTAGTCGTTTCC[A/G]
TCGTTGCGAAGGTTCGCGAGTGCGCCGGAAGTATTCAAGAAGATTAATTGAAGACCGATTATTGCAAGGCAAGTCACACAGATCCTAAACACAATCCTTT

Reverse complement sequence

AAAGGATTGTGTTTAGGATCTGTGTGACTTGCCTTGCAATAATCGGTCTTCAATTAATCTTCTTGAATACTTCCGGCGCACTCGCGAACCTTCGCAACGA[T/C]
GGAAACGACTAACTATCACGCAAAATGAAGAAAAAGACTAATAAAAACCAAAGAAATAATACATAAAAAGTAAACAAACATGTAGATCATAATTTTAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.00% 23.00% 17.77% 33.26% NA
All Indica  2759 5.10% 37.60% 27.08% 30.26% NA
All Japonica  1512 68.70% 1.40% 2.31% 27.65% NA
Aus  269 1.50% 1.10% 14.50% 82.90% NA
Indica I  595 4.40% 19.80% 32.44% 43.36% NA
Indica II  465 12.70% 26.50% 26.88% 33.98% NA
Indica III  913 2.00% 58.60% 22.45% 16.98% NA
Indica Intermediate  786 4.70% 33.20% 28.50% 33.59% NA
Temperate Japonica  767 77.10% 2.00% 2.74% 18.25% NA
Tropical Japonica  504 62.90% 1.20% 2.18% 33.73% NA
Japonica Intermediate  241 53.90% 0.00% 1.24% 44.81% NA
VI/Aromatic  96 11.50% 13.50% 10.42% 64.58% NA
Intermediate  90 38.90% 13.30% 10.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210564472 A -> DEL N N silent_mutation Average:16.349; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg1210564472 A -> G LOC_Os12g18310.1 upstream_gene_variant ; 2026.0bp to feature; MODIFIER silent_mutation Average:16.349; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg1210564472 A -> G LOC_Os12g18300.1 downstream_gene_variant ; 4997.0bp to feature; MODIFIER silent_mutation Average:16.349; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg1210564472 A -> G LOC_Os12g18300-LOC_Os12g18310 intergenic_region ; MODIFIER silent_mutation Average:16.349; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210564472 NA 3.86E-11 mr1156 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 1.42E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 7.71E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 9.30E-06 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 1.56E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 1.73E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 8.88E-07 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 7.50E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 2.85E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 8.64E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 4.22E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 2.37E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 2.88E-09 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 1.64E-06 7.07E-08 mr1391_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 2.98E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 9.87E-08 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210564472 NA 3.84E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251