\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210553397:

Variant ID: vg1210553397 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10553397
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, C: 0.05, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGCTTCGGCAAACAACTGACGATGTCTTCTTCTTCACTGACCTGACCATCCAGTACTAGTTGAAATCCGAAGAAGGAAGAAGGGAGTAAACATTTTG[A/C]
AAATAGCATTAGGGAAAGGAGGAAAAGGAACTTTCGCAAATAGTTTCATTTATAAAATATGTCCTTAGGTTTTATCCACTTGGCTTATCCTACAGTCGAG

Reverse complement sequence

CTCGACTGTAGGATAAGCCAAGTGGATAAAACCTAAGGACATATTTTATAAATGAAACTATTTGCGAAAGTTCCTTTTCCTCCTTTCCCTAATGCTATTT[T/G]
CAAAATGTTTACTCCCTTCTTCCTTCTTCGGATTTCAACTAGTACTGGATGGTCAGGTCAGTGAAGAAGAAGACATCGTCAGTTGTTTGCCGAAGCTCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 10.00% 6.77% 8.02% NA
All Indica  2759 84.00% 5.50% 6.13% 4.31% NA
All Japonica  1512 72.70% 2.80% 7.54% 16.93% NA
Aus  269 17.80% 72.90% 9.29% 0.00% NA
Indica I  595 85.20% 1.80% 4.54% 8.40% NA
Indica II  465 93.10% 0.60% 2.15% 4.09% NA
Indica III  913 82.60% 8.30% 8.43% 0.66% NA
Indica Intermediate  786 79.40% 8.00% 7.00% 5.60% NA
Temperate Japonica  767 81.10% 0.70% 1.43% 16.82% NA
Tropical Japonica  504 66.70% 6.00% 17.26% 10.12% NA
Japonica Intermediate  241 58.50% 3.30% 6.64% 31.54% NA
VI/Aromatic  96 21.90% 70.80% 7.29% 0.00% NA
Intermediate  90 75.60% 14.40% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210553397 A -> C LOC_Os12g18300.1 upstream_gene_variant ; 2883.0bp to feature; MODIFIER silent_mutation Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1210553397 A -> C LOC_Os12g18280.1 downstream_gene_variant ; 4310.0bp to feature; MODIFIER silent_mutation Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1210553397 A -> C LOC_Os12g18290.1 intron_variant ; MODIFIER silent_mutation Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N
vg1210553397 A -> DEL N N silent_mutation Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210553397 NA 9.68E-20 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1210553397 NA 1.89E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 1.22E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 1.76E-10 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 3.03E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 4.63E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 3.39E-09 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 2.52E-08 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 7.99E-07 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 1.16E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 3.99E-07 mr1204_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 1.64E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 1.87E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 6.70E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 2.10E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 3.48E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397 NA 7.04E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251