Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210553397:

Variant ID: vg1210553397 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10553397
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, C: 0.05, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAGCTTCGGCAAACAACTGACGATGTCTTCTTCTTCACTGACCTGACCATCCAGTACTAGTTGAAATCCGAAGAAGGAAGAAGGGAGTAAACATTTTG[A/C]
AAATAGCATTAGGGAAAGGAGGAAAAGGAACTTTCGCAAATAGTTTCATTTATAAAATATGTCCTTAGGTTTTATCCACTTGGCTTATCCTACAGTCGAG

Reverse complement sequence

CTCGACTGTAGGATAAGCCAAGTGGATAAAACCTAAGGACATATTTTATAAATGAAACTATTTGCGAAAGTTCCTTTTCCTCCTTTCCCTAATGCTATTT[T/G]
CAAAATGTTTACTCCCTTCTTCCTTCTTCGGATTTCAACTAGTACTGGATGGTCAGGTCAGTGAAGAAGAAGACATCGTCAGTTGTTTGCCGAAGCTCCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	10.00%	6.77%	8.02%	NA
All Indica	2759	84.00%	5.50%	6.13%	4.31%	NA
All Japonica	1512	72.70%	2.80%	7.54%	16.93%	NA
Aus	269	17.80%	72.90%	9.29%	0.00%	NA
Indica I	595	85.20%	1.80%	4.54%	8.40%	NA
Indica II	465	93.10%	0.60%	2.15%	4.09%	NA
Indica III	913	82.60%	8.30%	8.43%	0.66%	NA
Indica Intermediate	786	79.40%	8.00%	7.00%	5.60%	NA
Temperate Japonica	767	81.10%	0.70%	1.43%	16.82%	NA
Tropical Japonica	504	66.70%	6.00%	17.26%	10.12%	NA
Japonica Intermediate	241	58.50%	3.30%	6.64%	31.54%	NA
VI/Aromatic	96	21.90%	70.80%	7.29%	0.00%	NA
Intermediate	90	75.60%	14.40%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210553397	A -> C	LOC_Os12g18300.1	upstream_gene_variant ; 2883.0bp to feature; MODIFIER	silent_mutation	Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327	N	N	N	N
vg1210553397	A -> C	LOC_Os12g18280.1	downstream_gene_variant ; 4310.0bp to feature; MODIFIER	silent_mutation	Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327	N	N	N	N
vg1210553397	A -> C	LOC_Os12g18290.1	intron_variant ; MODIFIER	silent_mutation	Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327	N	N	N	N
vg1210553397	A -> DEL	N	N	silent_mutation	Average:39.609; most accessible tissue: Minghui63 flag leaf, score: 85.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210553397	NA	9.68E-20	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1210553397	NA	1.89E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	1.22E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	1.76E-10	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	3.03E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	4.63E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	3.39E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	2.52E-08	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	7.99E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	1.16E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	3.99E-07	mr1204_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	1.64E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	1.87E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	6.70E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	2.10E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	3.48E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210553397	NA	7.04E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251