\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210429306:

Variant ID: vg1210429306 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10429306
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.16, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCATGATATTGCACCGATAGAAATTAATCTTAGTTGGTTGCATGCAACATATTCAATGATGCTGTCGGTGATATGGGCCTGGGGTATCAGGTTTAGAG[G/A]
GAGGAGGCTGCCCCTCGATGCCACGTGGCCCTCCCCCGAGGGGAGTCAGGCCCGAGGTGGGGTGGCGGCCACTCCTTCCCCAAAGACTAGTCGGAGGAGG

Reverse complement sequence

CCTCCTCCGACTAGTCTTTGGGGAAGGAGTGGCCGCCACCCCACCTCGGGCCTGACTCCCCTCGGGGGAGGGCCACGTGGCATCGAGGGGCAGCCTCCTC[C/T]
CTCTAAACCTGATACCCCAGGCCCATATCACCGACAGCATCATTGAATATGTTGCATGCAACCAACTAAGATTAATTTCTATCGGTGCAATATCATGCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 44.20% 2.62% 0.04% NA
All Indica  2759 67.20% 29.50% 3.23% 0.00% NA
All Japonica  1512 27.60% 70.70% 1.72% 0.00% NA
Aus  269 53.50% 45.00% 1.49% 0.00% NA
Indica I  595 89.70% 5.00% 5.21% 0.00% NA
Indica II  465 49.70% 48.60% 1.72% 0.00% NA
Indica III  913 63.30% 33.80% 2.85% 0.00% NA
Indica Intermediate  786 65.10% 31.80% 3.05% 0.00% NA
Temperate Japonica  767 22.00% 76.90% 1.04% 0.00% NA
Tropical Japonica  504 30.20% 67.90% 1.98% 0.00% NA
Japonica Intermediate  241 39.80% 56.80% 3.32% 0.00% NA
VI/Aromatic  96 64.60% 33.30% 1.04% 1.04% NA
Intermediate  90 34.40% 60.00% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210429306 G -> DEL N N silent_mutation Average:81.927; most accessible tissue: Zhenshan97 flag leaf, score: 89.066 N N N N
vg1210429306 G -> A LOC_Os12g18110.1 upstream_gene_variant ; 3478.0bp to feature; MODIFIER silent_mutation Average:81.927; most accessible tissue: Zhenshan97 flag leaf, score: 89.066 N N N N
vg1210429306 G -> A LOC_Os12g18110.2 upstream_gene_variant ; 3478.0bp to feature; MODIFIER silent_mutation Average:81.927; most accessible tissue: Zhenshan97 flag leaf, score: 89.066 N N N N
vg1210429306 G -> A LOC_Os12g18110.3 upstream_gene_variant ; 3478.0bp to feature; MODIFIER silent_mutation Average:81.927; most accessible tissue: Zhenshan97 flag leaf, score: 89.066 N N N N
vg1210429306 G -> A LOC_Os12g18110-LOC_Os12g18120 intergenic_region ; MODIFIER silent_mutation Average:81.927; most accessible tissue: Zhenshan97 flag leaf, score: 89.066 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1210429306 G A 0.0 0.0 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210429306 3.88E-06 1.42E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 2.45E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 1.66E-06 2.41E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 1.92E-06 5.02E-13 mr1079 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 2.06E-06 2.12E-10 mr1132 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 9.49E-06 4.57E-11 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 4.96E-09 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 1.15E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 3.19E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 6.28E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 9.59E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 4.80E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 9.58E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 4.53E-07 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 5.24E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 4.69E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 6.86E-07 2.85E-12 mr1390 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 1.48E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 3.01E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 2.78E-06 1.43E-11 mr1490 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 2.22E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 2.26E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 6.69E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 3.09E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 1.25E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 9.47E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 7.97E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 2.30E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 5.21E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210429306 NA 8.52E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251