\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210427460:

Variant ID: vg1210427460 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10427460
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.20, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATGCGGAAATCCTTCCATCCTGCTTTTCAGATTCTCAGGGAATCCATGGTTTTCTCTTGTAACCATAGTTTGTAAAAAAACTTTGTTTTCTACTTCT[C/T]
CTATTATGAAATTGGCAGAGCTCCTACCCTTTACTCCTAAAAAACTTTGTTTTCAGATTCTCAGCTAATTTTGTTTTCTTCATTCTACGCGGCACGGTGT

Reverse complement sequence

ACACCGTGCCGCGTAGAATGAAGAAAACAAAATTAGCTGAGAATCTGAAAACAAAGTTTTTTAGGAGTAAAGGGTAGGAGCTCTGCCAATTTCATAATAG[G/A]
AGAAGTAGAAAACAAAGTTTTTTTACAAACTATGGTTACAAGAGAAAACCATGGATTCCCTGAGAATCTGAAAAGCAGGATGGAAGGATTTCCGCATAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.20% 0.38% 0.00% NA
All Indica  2759 75.40% 24.00% 0.54% 0.00% NA
All Japonica  1512 31.30% 68.60% 0.07% 0.00% NA
Aus  269 54.60% 45.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.50% 0.34% 0.00% NA
Indica II  465 53.80% 45.60% 0.65% 0.00% NA
Indica III  913 75.50% 24.00% 0.55% 0.00% NA
Indica Intermediate  786 72.50% 26.80% 0.64% 0.00% NA
Temperate Japonica  767 23.30% 76.50% 0.13% 0.00% NA
Tropical Japonica  504 37.10% 62.90% 0.00% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210427460 C -> T LOC_Os12g18110.1 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:66.348; most accessible tissue: Minghui63 root, score: 88.953 N N N N
vg1210427460 C -> T LOC_Os12g18110.2 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:66.348; most accessible tissue: Minghui63 root, score: 88.953 N N N N
vg1210427460 C -> T LOC_Os12g18110.3 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:66.348; most accessible tissue: Minghui63 root, score: 88.953 N N N N
vg1210427460 C -> T LOC_Os12g18110-LOC_Os12g18120 intergenic_region ; MODIFIER silent_mutation Average:66.348; most accessible tissue: Minghui63 root, score: 88.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210427460 NA 4.37E-12 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 2.21E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 6.10E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 1.38E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 1.81E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 5.61E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 1.66E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 3.39E-06 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 2.33E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 5.42E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 7.65E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 2.47E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 3.35E-08 mr1482 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 7.20E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 5.50E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 2.46E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 2.18E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 6.51E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 7.92E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 5.78E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 8.13E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210427460 NA 5.24E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251