\
| Variant ID: vg1210393974 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10393974 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 177. )
TGTAATGGTGTCCTTCGCTTTAAAGGCAGAGTCTGGATAGATAACAATCCATCTGTGCAGGATAAGATTATCTCTGCGTTGCACAGTAGTCCTTTGGGGG[G/A]
GCACTCTGGTTTTCCTGTTACTTATAGTAAAATCAAGTCTCTTTTTGCTTGGCCCAAGATGAAGAAACAGATTCATACTGCTGTCAAAACATGTGGTATT
AATACCACATGTTTTGACAGCAGTATGAATCTGTTTCTTCATCTTGGGCCAAGCAAAAAGAGACTTGATTTTACTATAAGTAACAGGAAAACCAGAGTGC[C/T]
CCCCCAAAGGACTACTGTGCAACGCAGAGATAATCTTATCCTGCACAGATGGATTGTTATCTATCCAGACTCTGCCTTTAAAGCGAAGGACACCATTACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.40% | 25.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 72.50% | 27.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 57.60% | 42.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 66.20% | 33.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 67.70% | 32.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.00% | 34.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210393974 | G -> A | LOC_Os12g18080.1 | missense_variant ; p.Gly1027Glu; MODERATE | nonsynonymous_codon ; G1027E | Average:39.878; most accessible tissue: Minghui63 flag leaf, score: 57.188 | probably damaging |
2.673 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210393974 | NA | 2.55E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 2.13E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 2.79E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 2.05E-06 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | 1.44E-07 | 1.44E-07 | mr1663 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 1.67E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 1.53E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 8.11E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | 9.72E-06 | 1.13E-08 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 5.56E-07 | mr1425_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210393974 | NA | 2.62E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |