\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210368322:

Variant ID: vg1210368322 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10368322
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACGACGCTATGATTGGGTCTTCAAATAAAGAACAAGAATCGCCTCACGCTCAGCTAGGAACATCCTCAGGTAACTCATCTTCTCAAGTGATGCCGAT[T/G]
TGAATAGCTCCAGCTTATTCGTCTAATATCTTGGAAATACATCAGGACCACCAGGCGATGACGAAGAAGAAATCCCTCGCATAAAGGCGGCTGACGACTC

Reverse complement sequence

GAGTCGTCAGCCGCCTTTATGCGAGGGATTTCTTCTTCGTCATCGCCTGGTGGTCCTGATGTATTTCCAAGATATTAGACGAATAAGCTGGAGCTATTCA[A/C]
ATCGGCATCACTTGAGAAGATGAGTTACCTGAGGATGTTCCTAGCTGAGCGTGAGGCGATTCTTGTTCTTTATTTGAAGACCCAATCATAGCGTCGTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.80% 27.00% 13.86% 29.35% NA
All Indica  2759 46.50% 5.90% 16.46% 31.06% NA
All Japonica  1512 4.50% 69.30% 4.30% 21.89% NA
Aus  269 8.90% 5.90% 43.87% 41.26% NA
Indica I  595 21.50% 3.40% 17.98% 57.14% NA
Indica II  465 34.40% 13.30% 15.27% 36.99% NA
Indica III  913 71.30% 3.20% 14.90% 10.62% NA
Indica Intermediate  786 43.90% 6.70% 17.81% 31.55% NA
Temperate Japonica  767 0.50% 77.80% 3.13% 18.51% NA
Tropical Japonica  504 11.70% 62.70% 5.36% 20.24% NA
Japonica Intermediate  241 2.10% 56.00% 5.81% 36.10% NA
VI/Aromatic  96 14.60% 10.40% 8.33% 66.67% NA
Intermediate  90 21.10% 41.10% 11.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210368322 T -> DEL N N silent_mutation Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg1210368322 T -> G LOC_Os12g18020.1 upstream_gene_variant ; 4589.0bp to feature; MODIFIER silent_mutation Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg1210368322 T -> G LOC_Os12g18040.1 downstream_gene_variant ; 1513.0bp to feature; MODIFIER silent_mutation Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg1210368322 T -> G LOC_Os12g18030.1 intron_variant ; MODIFIER silent_mutation Average:35.931; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210368322 NA 2.56E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322 NA 3.69E-07 mr1129 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322 NA 2.51E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322 NA 9.05E-07 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210368322 NA 1.39E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251