\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210329192:

Variant ID: vg1210329192 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10329192
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGGTATGTACTGGTATGAAGTGAGCAACCTTAGTGAGTCGATCCACGACTACCCAGATTGAATCGTGACCCGATGATGTCCAGGGCAGTCCTGTTATA[G/A]
AGTCCATTCCAATCTCCTCCCATTTCCATTCCAGGATTTGAAGAGGTTGGTGTAGACCTGCTGGTCTTTGGTGCTCTGCCTTCACTCGCTGGCAAACATC

Reverse complement sequence

GATGTTTGCCAGCGAGTGAAGGCAGAGCACCAAAGACCAGCAGGTCTACACCAACCTCTTCAAATCCTGGAATGGAAATGGGAGGAGATTGGAATGGACT[C/T]
TATAACAGGACTGCCCTGGACATCATCGGGTCACGATTCAATCTGGGTAGTCGTGGATCGACTCACTAAGGTTGCTCACTTCATACCAGTACATACCACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.40% 2.90% 24.88% 44.90% NA
All Indica  2759 6.30% 0.50% 28.96% 64.26% NA
All Japonica  1512 69.60% 7.90% 12.10% 10.38% NA
Aus  269 7.40% 0.00% 48.33% 44.24% NA
Indica I  595 4.50% 1.50% 26.89% 67.06% NA
Indica II  465 13.80% 0.00% 13.12% 73.12% NA
Indica III  913 2.10% 0.10% 37.79% 60.02% NA
Indica Intermediate  786 8.00% 0.50% 29.64% 61.83% NA
Temperate Japonica  767 77.80% 12.40% 2.61% 7.17% NA
Tropical Japonica  504 63.70% 0.00% 23.41% 12.90% NA
Japonica Intermediate  241 56.00% 10.00% 18.67% 15.35% NA
VI/Aromatic  96 10.40% 0.00% 41.67% 47.92% NA
Intermediate  90 41.10% 2.20% 26.67% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210329192 G -> DEL N N silent_mutation Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg1210329192 G -> A LOC_Os12g17970.1 upstream_gene_variant ; 413.0bp to feature; MODIFIER silent_mutation Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg1210329192 G -> A LOC_Os12g17960.1 downstream_gene_variant ; 4545.0bp to feature; MODIFIER silent_mutation Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg1210329192 G -> A LOC_Os12g17980.1 downstream_gene_variant ; 432.0bp to feature; MODIFIER silent_mutation Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg1210329192 G -> A LOC_Os12g17990.1 downstream_gene_variant ; 3824.0bp to feature; MODIFIER silent_mutation Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg1210329192 G -> A LOC_Os12g17970-LOC_Os12g17980 intergenic_region ; MODIFIER silent_mutation Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210329192 NA 2.04E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1210329192 NA 1.47E-10 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 1.85E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 7.24E-06 mr1173 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 3.34E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 1.20E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 1.16E-06 1.16E-06 mr1258 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 6.41E-09 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 3.78E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 8.31E-06 mr1293 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 8.05E-06 mr1294 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 4.84E-08 mr1318 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 4.74E-06 mr1507 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 3.94E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 5.59E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 1.82E-06 mr1810 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 8.72E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 1.04E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192 NA 5.74E-07 mr1425_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251