Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1210329192:

Variant ID: vg1210329192 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10329192
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGGTATGTACTGGTATGAAGTGAGCAACCTTAGTGAGTCGATCCACGACTACCCAGATTGAATCGTGACCCGATGATGTCCAGGGCAGTCCTGTTATA[G/A]
AGTCCATTCCAATCTCCTCCCATTTCCATTCCAGGATTTGAAGAGGTTGGTGTAGACCTGCTGGTCTTTGGTGCTCTGCCTTCACTCGCTGGCAAACATC

Reverse complement sequence

GATGTTTGCCAGCGAGTGAAGGCAGAGCACCAAAGACCAGCAGGTCTACACCAACCTCTTCAAATCCTGGAATGGAAATGGGAGGAGATTGGAATGGACT[C/T]
TATAACAGGACTGCCCTGGACATCATCGGGTCACGATTCAATCTGGGTAGTCGTGGATCGACTCACTAAGGTTGCTCACTTCATACCAGTACATACCACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.40%	2.90%	24.88%	44.90%	NA
All Indica	2759	6.30%	0.50%	28.96%	64.26%	NA
All Japonica	1512	69.60%	7.90%	12.10%	10.38%	NA
Aus	269	7.40%	0.00%	48.33%	44.24%	NA
Indica I	595	4.50%	1.50%	26.89%	67.06%	NA
Indica II	465	13.80%	0.00%	13.12%	73.12%	NA
Indica III	913	2.10%	0.10%	37.79%	60.02%	NA
Indica Intermediate	786	8.00%	0.50%	29.64%	61.83%	NA
Temperate Japonica	767	77.80%	12.40%	2.61%	7.17%	NA
Tropical Japonica	504	63.70%	0.00%	23.41%	12.90%	NA
Japonica Intermediate	241	56.00%	10.00%	18.67%	15.35%	NA
VI/Aromatic	96	10.40%	0.00%	41.67%	47.92%	NA
Intermediate	90	41.10%	2.20%	26.67%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210329192	G -> DEL	N	N	silent_mutation	Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg1210329192	G -> A	LOC_Os12g17970.1	upstream_gene_variant ; 413.0bp to feature; MODIFIER	silent_mutation	Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg1210329192	G -> A	LOC_Os12g17960.1	downstream_gene_variant ; 4545.0bp to feature; MODIFIER	silent_mutation	Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg1210329192	G -> A	LOC_Os12g17980.1	downstream_gene_variant ; 432.0bp to feature; MODIFIER	silent_mutation	Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg1210329192	G -> A	LOC_Os12g17990.1	downstream_gene_variant ; 3824.0bp to feature; MODIFIER	silent_mutation	Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N
vg1210329192	G -> A	LOC_Os12g17970-LOC_Os12g17980	intergenic_region ; MODIFIER	silent_mutation	Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210329192	NA	2.04E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1210329192	NA	1.47E-10	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	1.85E-08	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	7.24E-06	mr1173	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	3.34E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	1.20E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	1.16E-06	1.16E-06	mr1258	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	6.41E-09	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	3.78E-07	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	8.31E-06	mr1293	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	8.05E-06	mr1294	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	4.84E-08	mr1318	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	4.74E-06	mr1507	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	3.94E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	5.59E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	1.82E-06	mr1810	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	8.72E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	1.04E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329192	NA	5.74E-07	mr1425_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251