\
| Variant ID: vg1210329192 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10329192 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 90. )
CGTGGTATGTACTGGTATGAAGTGAGCAACCTTAGTGAGTCGATCCACGACTACCCAGATTGAATCGTGACCCGATGATGTCCAGGGCAGTCCTGTTATA[G/A]
AGTCCATTCCAATCTCCTCCCATTTCCATTCCAGGATTTGAAGAGGTTGGTGTAGACCTGCTGGTCTTTGGTGCTCTGCCTTCACTCGCTGGCAAACATC
GATGTTTGCCAGCGAGTGAAGGCAGAGCACCAAAGACCAGCAGGTCTACACCAACCTCTTCAAATCCTGGAATGGAAATGGGAGGAGATTGGAATGGACT[C/T]
TATAACAGGACTGCCCTGGACATCATCGGGTCACGATTCAATCTGGGTAGTCGTGGATCGACTCACTAAGGTTGCTCACTTCATACCAGTACATACCACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.40% | 2.90% | 24.88% | 44.90% | NA |
| All Indica | 2759 | 6.30% | 0.50% | 28.96% | 64.26% | NA |
| All Japonica | 1512 | 69.60% | 7.90% | 12.10% | 10.38% | NA |
| Aus | 269 | 7.40% | 0.00% | 48.33% | 44.24% | NA |
| Indica I | 595 | 4.50% | 1.50% | 26.89% | 67.06% | NA |
| Indica II | 465 | 13.80% | 0.00% | 13.12% | 73.12% | NA |
| Indica III | 913 | 2.10% | 0.10% | 37.79% | 60.02% | NA |
| Indica Intermediate | 786 | 8.00% | 0.50% | 29.64% | 61.83% | NA |
| Temperate Japonica | 767 | 77.80% | 12.40% | 2.61% | 7.17% | NA |
| Tropical Japonica | 504 | 63.70% | 0.00% | 23.41% | 12.90% | NA |
| Japonica Intermediate | 241 | 56.00% | 10.00% | 18.67% | 15.35% | NA |
| VI/Aromatic | 96 | 10.40% | 0.00% | 41.67% | 47.92% | NA |
| Intermediate | 90 | 41.10% | 2.20% | 26.67% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210329192 | G -> DEL | N | N | silent_mutation | Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg1210329192 | G -> A | LOC_Os12g17970.1 | upstream_gene_variant ; 413.0bp to feature; MODIFIER | silent_mutation | Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg1210329192 | G -> A | LOC_Os12g17960.1 | downstream_gene_variant ; 4545.0bp to feature; MODIFIER | silent_mutation | Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg1210329192 | G -> A | LOC_Os12g17980.1 | downstream_gene_variant ; 432.0bp to feature; MODIFIER | silent_mutation | Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg1210329192 | G -> A | LOC_Os12g17990.1 | downstream_gene_variant ; 3824.0bp to feature; MODIFIER | silent_mutation | Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| vg1210329192 | G -> A | LOC_Os12g17970-LOC_Os12g17980 | intergenic_region ; MODIFIER | silent_mutation | Average:42.022; most accessible tissue: Minghui63 flag leaf, score: 79.676 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210329192 | NA | 2.04E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1210329192 | NA | 1.47E-10 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 1.85E-08 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 7.24E-06 | mr1173 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 3.34E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 1.20E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | 1.16E-06 | 1.16E-06 | mr1258 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 6.41E-09 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 3.78E-07 | mr1289 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 8.31E-06 | mr1293 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 8.05E-06 | mr1294 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 4.84E-08 | mr1318 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 4.74E-06 | mr1507 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 3.94E-08 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 5.59E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 1.82E-06 | mr1810 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 8.72E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 1.04E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210329192 | NA | 5.74E-07 | mr1425_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |