\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210329175:

Variant ID: vg1210329175 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10329175
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTTTTGCCCGTATACGTGGTATGTACTGGTATGAAGTGAGCAACCTTAGTGAGTCGATCCACGACTACCCAGATTGAATCGTGACCCGATGATGTCC[A/G]
GGGCAGTCCTGTTATAGAGTCCATTCCAATCTCCTCCCATTTCCATTCCAGGATTTGAAGAGGTTGGTGTAGACCTGCTGGTCTTTGGTGCTCTGCCTTC

Reverse complement sequence

GAAGGCAGAGCACCAAAGACCAGCAGGTCTACACCAACCTCTTCAAATCCTGGAATGGAAATGGGAGGAGATTGGAATGGACTCTATAACAGGACTGCCC[T/C]
GGACATCATCGGGTCACGATTCAATCTGGGTAGTCGTGGATCGACTCACTAAGGTTGCTCACTTCATACCAGTACATACCACGTATACGGGCAAAAGGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.80% 3.70% 27.51% 41.96% NA
All Indica  2759 5.70% 1.30% 31.03% 61.91% NA
All Japonica  1512 69.40% 7.90% 14.09% 8.60% NA
Aus  269 5.20% 5.60% 60.59% 28.62% NA
Indica I  595 4.70% 1.20% 28.24% 65.88% NA
Indica II  465 12.90% 0.00% 16.13% 70.97% NA
Indica III  913 2.00% 1.90% 38.66% 57.50% NA
Indica Intermediate  786 6.60% 1.70% 33.08% 58.65% NA
Temperate Japonica  767 77.70% 12.40% 3.13% 6.78% NA
Tropical Japonica  504 63.70% 0.00% 26.59% 9.72% NA
Japonica Intermediate  241 55.20% 10.00% 22.82% 12.03% NA
VI/Aromatic  96 10.40% 1.00% 47.92% 40.62% NA
Intermediate  90 40.00% 3.30% 24.44% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210329175 A -> DEL N N silent_mutation Average:40.055; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N
vg1210329175 A -> G LOC_Os12g17970.1 upstream_gene_variant ; 396.0bp to feature; MODIFIER silent_mutation Average:40.055; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N
vg1210329175 A -> G LOC_Os12g17960.1 downstream_gene_variant ; 4528.0bp to feature; MODIFIER silent_mutation Average:40.055; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N
vg1210329175 A -> G LOC_Os12g17980.1 downstream_gene_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:40.055; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N
vg1210329175 A -> G LOC_Os12g17990.1 downstream_gene_variant ; 3841.0bp to feature; MODIFIER silent_mutation Average:40.055; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N
vg1210329175 A -> G LOC_Os12g17970-LOC_Os12g17980 intergenic_region ; MODIFIER silent_mutation Average:40.055; most accessible tissue: Minghui63 flag leaf, score: 75.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210329175 NA 1.26E-10 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 1.17E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 3.79E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 1.16E-07 1.16E-07 mr1258 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 4.17E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 4.69E-07 mr1289 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 8.45E-06 mr1294 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 1.47E-07 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 1.00E-05 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 5.02E-06 mr1507 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 1.23E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 9.30E-06 mr1751 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 2.04E-06 mr1810 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210329175 NA 5.19E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251