Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210236191:

Variant ID: vg1210236191 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10236191
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAGATCGGAGCGGTTCTTGGTGCCAGATCAACCCGGAACTCGATCTCCCTCTTCGGTGGCATGGTAGTGAGGTCCTCGGGGAACACTTTTAGATGCTC[G/A]
CAAACAATAGGGATGTCCTCCAATTTCCTCGGACTCTTTTCCTCTGCGGCCACTGGATTTTTAACCTCAATCTGATTCAAAGAGACTCCTTGCTTCCGTG

Reverse complement sequence

CACGGAAGCAAGGAGTCTCTTTGAATCAGATTGAGGTTAAAAATCCAGTGGCCGCAGAGGAAAAGAGTCCGAGGAAATTGGAGGACATCCCTATTGTTTG[C/T]
GAGCATCTAAAAGTGTTCCCCGAGGACCTCACTACCATGCCACCGAAGAGGGAGATCGAGTTCCGGGTTGATCTGGCACCAAGAACCGCTCCGATCTACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	9.40%	0.53%	6.98%	NA
All Indica	2759	82.70%	5.30%	0.87%	11.16%	NA
All Japonica	1512	81.40%	18.50%	0.07%	0.07%	NA
Aus	269	91.80%	3.30%	0.00%	4.83%	NA
Indica I	595	96.30%	2.50%	0.00%	1.18%	NA
Indica II	465	87.10%	0.20%	0.22%	12.47%	NA
Indica III	913	74.40%	8.30%	1.64%	15.66%	NA
Indica Intermediate	786	79.50%	6.70%	1.02%	12.72%	NA
Temperate Japonica	767	95.70%	4.00%	0.13%	0.13%	NA
Tropical Japonica	504	65.90%	34.10%	0.00%	0.00%	NA
Japonica Intermediate	241	68.50%	31.50%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	85.60%	12.20%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210236191	G -> DEL	LOC_Os12g17860.1	N	frameshift_variant	Average:52.398; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg1210236191	G -> A	LOC_Os12g17860.1	synonymous_variant ; p.Cys588Cys; LOW	synonymous_codon	Average:52.398; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210236191	NA	3.35E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.55E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.08E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	6.38E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	2.86E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	8.82E-06	8.82E-06	mr1663	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	2.83E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.55E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	8.44E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	2.99E-06	mr1046_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	6.12E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	7.04E-07	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	3.11E-07	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.81E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	8.06E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	3.21E-06	mr1283_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.16E-06	mr1288_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	3.37E-07	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	5.32E-06	5.32E-06	mr1357_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.05E-06	mr1421_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.42E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	4.52E-06	mr1432_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	6.59E-06	mr1554_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	9.85E-06	mr1555_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	3.88E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	7.40E-06	7.40E-06	mr1573_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	7.14E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	1.11E-06	1.11E-06	mr1643_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	3.84E-06	mr1661_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	8.36E-07	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.60E-06	mr1702_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	5.40E-07	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	3.70E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	8.37E-06	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	2.70E-06	mr1752_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	4.36E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.77E-06	mr1784_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	2.27E-06	mr1785_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.64E-06	mr1788_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	1.77E-08	mr1800_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	3.25E-07	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	3.61E-06	3.61E-06	mr1941_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210236191	NA	2.00E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251