Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210225671:

Variant ID: vg1210225671 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10225671
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTACACAATGCCCTAGTCTAATCAAACCTCTGTTAGTGATATGCCGTAGAGGCAATCATAGAGATGATTGTATCATATACTATGTTTACATATTTAT[T/C]
TGACATTATTCCTTGAAATAGATAATTCATTATTGGTTAATGAATATGTGATTCTTTCATGAGACTCTTTATATTGTATGTTACTATTTCTGAAGGATCC

Reverse complement sequence

GGATCCTTCAGAAATAGTAACATACAATATAAAGAGTCTCATGAAAGAATCACATATTCATTAACCAATAATGAATTATCTATTTCAAGGAATAATGTCA[A/G]
ATAAATATGTAAACATAGTATATGATACAATCATCTCTATGATTGCCTCTACGGCATATCACTAACAGAGGTTTGATTAGACTAGGGCATTGTGTAAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	42.20%	1.02%	7.05%	NA
All Indica	2759	64.00%	23.10%	1.12%	11.78%	NA
All Japonica	1512	22.90%	76.90%	0.00%	0.13%	NA
Aus	269	53.20%	41.60%	5.20%	0.00%	NA
Indica I	595	95.10%	3.20%	0.50%	1.18%	NA
Indica II	465	41.70%	45.40%	0.00%	12.90%	NA
Indica III	913	59.10%	22.20%	1.64%	16.98%	NA
Indica Intermediate	786	59.30%	26.00%	1.65%	13.10%	NA
Temperate Japonica	767	10.70%	89.20%	0.00%	0.13%	NA
Tropical Japonica	504	36.50%	63.30%	0.00%	0.20%	NA
Japonica Intermediate	241	33.60%	66.40%	0.00%	0.00%	NA
VI/Aromatic	96	61.50%	32.30%	2.08%	4.17%	NA
Intermediate	90	38.90%	57.80%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210225671	T -> C	LOC_Os12g17840-LOC_Os12g17850	intergenic_region ; MODIFIER	silent_mutation	Average:33.235; most accessible tissue: Zhenshan97 young leaf, score: 55.261	N	N	N	N
vg1210225671	T -> DEL	N	N	silent_mutation	Average:33.235; most accessible tissue: Zhenshan97 young leaf, score: 55.261	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210225671	NA	4.06E-12	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	1.86E-10	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	1.47E-31	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	9.14E-13	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	2.00E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	1.95E-11	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	8.74E-06	1.04E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	9.25E-06	3.34E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	1.04E-06	1.52E-11	mr1142	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	2.21E-06	3.54E-13	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	2.61E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	1.00E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	2.06E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	1.51E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	6.52E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	5.39E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	6.55E-09	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	9.99E-06	mr1399_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671	NA	9.28E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251