\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210225671:

Variant ID: vg1210225671 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10225671
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTACACAATGCCCTAGTCTAATCAAACCTCTGTTAGTGATATGCCGTAGAGGCAATCATAGAGATGATTGTATCATATACTATGTTTACATATTTAT[T/C]
TGACATTATTCCTTGAAATAGATAATTCATTATTGGTTAATGAATATGTGATTCTTTCATGAGACTCTTTATATTGTATGTTACTATTTCTGAAGGATCC

Reverse complement sequence

GGATCCTTCAGAAATAGTAACATACAATATAAAGAGTCTCATGAAAGAATCACATATTCATTAACCAATAATGAATTATCTATTTCAAGGAATAATGTCA[A/G]
ATAAATATGTAAACATAGTATATGATACAATCATCTCTATGATTGCCTCTACGGCATATCACTAACAGAGGTTTGATTAGACTAGGGCATTGTGTAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 42.20% 1.02% 7.05% NA
All Indica  2759 64.00% 23.10% 1.12% 11.78% NA
All Japonica  1512 22.90% 76.90% 0.00% 0.13% NA
Aus  269 53.20% 41.60% 5.20% 0.00% NA
Indica I  595 95.10% 3.20% 0.50% 1.18% NA
Indica II  465 41.70% 45.40% 0.00% 12.90% NA
Indica III  913 59.10% 22.20% 1.64% 16.98% NA
Indica Intermediate  786 59.30% 26.00% 1.65% 13.10% NA
Temperate Japonica  767 10.70% 89.20% 0.00% 0.13% NA
Tropical Japonica  504 36.50% 63.30% 0.00% 0.20% NA
Japonica Intermediate  241 33.60% 66.40% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 32.30% 2.08% 4.17% NA
Intermediate  90 38.90% 57.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210225671 T -> C LOC_Os12g17840-LOC_Os12g17850 intergenic_region ; MODIFIER silent_mutation Average:33.235; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg1210225671 T -> DEL N N silent_mutation Average:33.235; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210225671 NA 4.06E-12 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 1.86E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 1.47E-31 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 9.14E-13 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 2.00E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 1.95E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 8.74E-06 1.04E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 9.25E-06 3.34E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 1.04E-06 1.52E-11 mr1142 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 2.21E-06 3.54E-13 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 2.61E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 1.00E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 2.06E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 1.51E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 6.52E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 5.39E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 6.55E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 9.99E-06 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210225671 NA 9.28E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251