Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210166587:

Variant ID: vg1210166587 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10166587
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, C: 0.47, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAATCTCACCGCACGCTGGCCGCCACCCGATGATCTCCTTAGCAGGGAGAACGCCGTGCGCCATCATCTCCTTCAGGTTCTCTTCCGTTACGTCAGA[C/T]
GGCGCCCATTGGCCTTCAAAGCTTTCTTTCTCCTCCGCCATCGATTTTACCCGAATGCGCTGATTTGATTCGAGGGATGGCCGGGGAGAAGTGAGGGATT

Reverse complement sequence

AATCCCTCACTTCTCCCCGGCCATCCCTCGAATCAAATCAGCGCATTCGGGTAAAATCGATGGCGGAGGAGAAAGAAAGCTTTGAAGGCCAATGGGCGCC[G/A]
TCTGACGTAACGGAAGAGAACCTGAAGGAGATGATGGCGCACGGCGTTCTCCCTGCTAAGGAGATCATCGGGTGGCGGCCAGCGTGCGGTGAGATTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.10% 14.50% 16.86% 40.58% NA
All Indica  2759 6.60% 11.30% 20.33% 61.76% NA
All Japonica  1512 66.30% 20.00% 4.37% 9.26% NA
Aus  269 32.00% 6.30% 47.21% 14.50% NA
Indica I  595 4.70% 5.40% 6.89% 83.03% NA
Indica II  465 13.10% 1.50% 18.28% 67.10% NA
Indica III  913 3.60% 17.70% 27.60% 51.04% NA
Indica Intermediate  786 7.50% 14.20% 23.28% 54.96% NA
Temperate Japonica  767 82.50% 7.30% 2.48% 7.69% NA
Tropical Japonica  504 50.20% 32.10% 5.56% 12.10% NA
Japonica Intermediate  241 48.50% 35.30% 7.88% 8.30% NA
VI/Aromatic  96 20.80% 34.40% 37.50% 7.29% NA
Intermediate  90 40.00% 21.10% 7.78% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210166587 C -> DEL LOC_Os12g17750.1 N frameshift_variant Average:27.809; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg1210166587 C -> T LOC_Os12g17750.1 synonymous_variant ; p.Pro14Pro; LOW synonymous_codon Average:27.809; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210166587 NA 8.93E-08 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 8.43E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 3.23E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 8.78E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 1.99E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 6.48E-10 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 3.65E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.51E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.64E-09 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 8.67E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 3.67E-06 mr1058_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 8.84E-06 mr1084_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 7.62E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.03E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 6.44E-06 mr1205_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.19E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 3.72E-08 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 3.56E-09 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.70E-06 mr1230_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 4.96E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.45E-06 mr1283_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 6.64E-06 mr1302_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 1.01E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 1.42E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 3.71E-08 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.93E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.50E-08 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 1.69E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.95E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.12E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 9.90E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.55E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.54E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 7.93E-08 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 1.41E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.80E-07 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 8.45E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.68E-07 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 6.74E-07 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 2.98E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 1.22E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 8.90E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 3.93E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.00E-08 mr1876_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 5.62E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 1.98E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 9.59E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 NA 4.23E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210166587 6.18E-06 6.17E-06 mr1967_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251