Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210154397:

Variant ID: vg1210154397 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10154397
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATATCTAGCTGAACCAATATATATAAGTCAAGTTCTAATAACCCAAGGTATCAAGGAATAAAGTAATCAAGAACAAAAAGGGCTATAACCAACAATAGGT[T/G]
AATTCCACCCAATGACATTCAAAAATAAGTGCAATAGTTGAATAGAAACAATAGCTTTAAACGGGATCAACATGCTCAAAGGGTTGTTTGGGATCTGTGT

Reverse complement sequence

ACACAGATCCCAAACAACCCTTTGAGCATGTTGATCCCGTTTAAAGCTATTGTTTCTATTCAACTATTGCACTTATTTTTGAATGTCATTGGGTGGAATT[A/C]
ACCTATTGTTGGTTATAGCCCTTTTTGTTCTTGATTACTTTATTCCTTGATACCTTGGGTTATTAGAACTTGACTTATATATATTGGTTCAGCTAGATAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	3.60%	1.59%	3.32%	NA
All Indica	2759	98.70%	0.30%	0.40%	0.58%	NA
All Japonica	1512	83.60%	10.40%	3.24%	2.71%	NA
Aus	269	67.70%	0.00%	4.83%	27.51%	NA
Indica I	595	99.30%	0.30%	0.34%	0.00%	NA
Indica II	465	98.90%	0.40%	0.00%	0.65%	NA
Indica III	913	99.10%	0.10%	0.11%	0.66%	NA
Indica Intermediate	786	97.70%	0.40%	1.02%	0.89%	NA
Temperate Japonica	767	88.40%	4.40%	4.95%	2.22%	NA
Tropical Japonica	504	74.80%	23.60%	1.39%	0.20%	NA
Japonica Intermediate	241	86.70%	2.10%	1.66%	9.54%	NA
VI/Aromatic	96	76.00%	0.00%	0.00%	23.96%	NA
Intermediate	90	87.80%	6.70%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210154397	T -> DEL	N	N	silent_mutation	Average:27.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg1210154397	T -> G	LOC_Os12g17740.1	upstream_gene_variant ; 2901.0bp to feature; MODIFIER	silent_mutation	Average:27.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg1210154397	T -> G	LOC_Os12g17730.1	downstream_gene_variant ; 57.0bp to feature; MODIFIER	silent_mutation	Average:27.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N
vg1210154397	T -> G	LOC_Os12g17710-LOC_Os12g17730	intergenic_region ; MODIFIER	silent_mutation	Average:27.793; most accessible tissue: Minghui63 flag leaf, score: 45.977	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210154397	NA	4.61E-06	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210154397	1.33E-06	1.33E-06	mr1244_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251