\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210140813:

Variant ID: vg1210140813 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10140813
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGCCCTGTAAATTTTTTACTACTAGTAGCACATTTATGTTGTGATAAAAAATTACTGTACCTTTTTTTTACTATATACCAGCAGCGATCTCGCTTGAT[G/A]
CACACATTTTCGTCTACGTCGTTGCCATGATTGCACGTGGTGAGCTCCGGCTAGGCCATGTCGAACAGCACGAAGAACTCACTGGCAAGCGAGGATTGGT

Reverse complement sequence

ACCAATCCTCGCTTGCCAGTGAGTTCTTCGTGCTGTTCGACATGGCCTAGCCGGAGCTCACCACGTGCAATCATGGCAACGACGTAGACGAAAATGTGTG[C/T]
ATCAAGCGAGATCGCTGCTGGTATATAGTAAAAAAAAGGTACAGTAATTTTTTATCACAACATAAATGTGCTACTAGTAGTAAAAAATTTACAGGGCAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 14.20% 0.11% 0.00% NA
All Indica  2759 94.50% 5.50% 0.04% 0.00% NA
All Japonica  1512 79.60% 20.30% 0.13% 0.00% NA
Aus  269 44.20% 55.40% 0.37% 0.00% NA
Indica I  595 97.30% 2.50% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 92.60% 7.40% 0.00% 0.00% NA
Temperate Japonica  767 93.00% 7.00% 0.00% 0.00% NA
Tropical Japonica  504 65.50% 34.50% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 32.80% 0.83% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210140813 G -> A LOC_Os12g17700.1 3_prime_UTR_variant ; 55.0bp to feature; MODIFIER silent_mutation Average:71.578; most accessible tissue: Callus, score: 87.124 N N N N
vg1210140813 G -> A LOC_Os12g17690.1 upstream_gene_variant ; 4463.0bp to feature; MODIFIER silent_mutation Average:71.578; most accessible tissue: Callus, score: 87.124 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210140813 NA 4.88E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 8.51E-06 mr1061_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 2.46E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 3.73E-06 mr1182_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 9.27E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 5.50E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 8.91E-08 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 8.20E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 2.64E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 3.46E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 1.42E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 3.36E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 3.47E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 4.51E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 7.14E-07 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 1.30E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 7.61E-07 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 1.61E-06 mr1740_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 6.53E-06 mr1741_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 7.85E-06 mr1751_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 6.56E-06 mr1752_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 2.75E-08 mr1788_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 9.74E-07 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210140813 NA 4.96E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251