\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210130843:

Variant ID: vg1210130843 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10130843
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGATGGTACGCCATTATTGGGCATGCTAACTTTGGATCCTACATGCTCCCCTGACTCCTTATCCTATAATAACGGTGTATTATACTAAACATTATTAT[G/T]
CTAAACAAATGAAATGAAATATTGATTAAGAGGGTCAATCAATTCGTGCAACACGCTCATAGAGTTTTAAATGAAGTGGAATAACCTGCAATGGTTCTTC

Reverse complement sequence

GAAGAACCATTGCAGGTTATTCCACTTCATTTAAAACTCTATGAGCGTGTTGCACGAATTGATTGACCCTCTTAATCAATATTTCATTTCATTTGTTTAG[C/A]
ATAATAATGTTTAGTATAATACACCGTTATTATAGGATAAGGAGTCAGGGGAGCATGTAGGATCCAAAGTTAGCATGCCCAATAATGGCGTACCATCGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 2.40% 20.00% 14.71% NA
All Indica  2759 51.40% 3.70% 31.35% 13.56% NA
All Japonica  1512 79.20% 0.10% 1.92% 18.78% NA
Aus  269 89.20% 1.90% 5.58% 3.35% NA
Indica I  595 55.00% 1.30% 30.92% 12.77% NA
Indica II  465 44.10% 3.70% 32.69% 19.57% NA
Indica III  913 51.20% 5.00% 32.53% 11.28% NA
Indica Intermediate  786 53.20% 4.10% 29.52% 13.23% NA
Temperate Japonica  767 88.70% 0.10% 0.65% 10.56% NA
Tropical Japonica  504 70.20% 0.20% 4.56% 25.00% NA
Japonica Intermediate  241 67.60% 0.00% 0.41% 31.95% NA
VI/Aromatic  96 57.30% 3.10% 26.04% 13.54% NA
Intermediate  90 70.00% 1.10% 12.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210130843 G -> DEL N N silent_mutation Average:43.866; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N
vg1210130843 G -> T LOC_Os12g17680.1 upstream_gene_variant ; 4726.0bp to feature; MODIFIER silent_mutation Average:43.866; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N
vg1210130843 G -> T LOC_Os12g17690.1 intron_variant ; MODIFIER silent_mutation Average:43.866; most accessible tissue: Minghui63 flag leaf, score: 69.182 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210130843 NA 2.88E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 3.24E-06 mr1076 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 4.20E-13 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 8.76E-07 mr1104 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 1.37E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 4.81E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 8.57E-13 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 8.16E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 5.60E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 2.53E-09 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 7.18E-12 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 1.34E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 1.94E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 3.43E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 6.90E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 1.91E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 2.75E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 2.64E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 2.29E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210130843 NA 5.01E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251