\
| Variant ID: vg1210128627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10128627 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.30, others allele: 0.00, population size: 118. )
CGTTTAACAATTTTTTGGTATATCTCATAGATGGGTTGTTCTCATACATTGGATTTAGTGGATTAGGGTCTAGAAGATAAAGTGTTCTGCTTTCTTGGTC[C/T]
AGTATGACCAAGATATAGCTTCCAACAGCACATACTGGTATAAGAATCTAGAAAAAGTCATCCGTCAAGATAATATAAAAAAACACTTTCAAATAAGAAC
GTTCTTATTTGAAAGTGTTTTTTTATATTATCTTGACGGATGACTTTTTCTAGATTCTTATACCAGTATGTGCTGTTGGAAGCTATATCTTGGTCATACT[G/A]
GACCAAGAAAGCAGAACACTTTATCTTCTAGACCCTAATCCACTAAATCCAATGTATGAGAACAACCCATCTATGAGATATACCAAAAAATTGTTAAACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.20% | 5.90% | 5.69% | 59.14% | NA |
| All Indica | 2759 | 5.80% | 7.30% | 7.58% | 79.34% | NA |
| All Japonica | 1512 | 77.30% | 1.60% | 0.20% | 20.90% | NA |
| Aus | 269 | 3.00% | 1.90% | 19.33% | 75.84% | NA |
| Indica I | 595 | 3.40% | 9.40% | 4.71% | 82.52% | NA |
| Indica II | 465 | 12.70% | 2.40% | 4.09% | 80.86% | NA |
| Indica III | 913 | 2.60% | 9.90% | 11.17% | 76.34% | NA |
| Indica Intermediate | 786 | 7.10% | 5.70% | 7.63% | 79.52% | NA |
| Temperate Japonica | 767 | 87.90% | 0.50% | 0.13% | 11.47% | NA |
| Tropical Japonica | 504 | 66.90% | 3.00% | 0.20% | 29.96% | NA |
| Japonica Intermediate | 241 | 65.60% | 2.10% | 0.41% | 31.95% | NA |
| VI/Aromatic | 96 | 7.30% | 43.80% | 2.08% | 46.88% | NA |
| Intermediate | 90 | 43.30% | 7.80% | 3.33% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210128627 | C -> DEL | N | N | silent_mutation | Average:26.194; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| vg1210128627 | C -> T | LOC_Os12g17680.1 | upstream_gene_variant ; 2510.0bp to feature; MODIFIER | silent_mutation | Average:26.194; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| vg1210128627 | C -> T | LOC_Os12g17690.1 | downstream_gene_variant ; 411.0bp to feature; MODIFIER | silent_mutation | Average:26.194; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| vg1210128627 | C -> T | LOC_Os12g17680-LOC_Os12g17690 | intergenic_region ; MODIFIER | silent_mutation | Average:26.194; most accessible tissue: Minghui63 flag leaf, score: 49.864 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210128627 | NA | 9.26E-06 | mr1870 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |