\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210110384:

Variant ID: vg1210110384 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 10110384
Reference Allele: CGAlternative Allele: GG,C
Primary Allele: CGSecondary Allele: GG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTTTGGTTATTACAAGTAATATAAAAATTATTAGTACGGTTCTCTCTATTATAATCTTCCCACGGGATTAAACAAAAATGATAACCTTGGAATACTCT[CG/GG,C]
GGTGAAATGCTACAATGATATAACCGTGCACTTGCGGATAAACTTTGTAACCGTAATATACCAGAAGTGTTTCTGCGCCATCGCTGGGAAATATATTTCT

Reverse complement sequence

AGAAATATATTTCCCAGCGATGGCGCAGAAACACTTCTGGTATATTACGGTTACAAAGTTTATCCGCAAGTGCACGGTTATATCATTGTAGCATTTCACC[CG/CC,G]
AGAGTATTCCAAGGTTATCATTTTTGTTTAATCCCGTGGGAAGATTATAATAGAGAGAACCGTACTAATAATTTTTATATTACTTGTAATAACCAAAGTC

Allele Frequencies:

Populations Population SizeFrequency of CG(primary allele) Frequency of GG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 33.60% 0.15% 0.00% C: 1.42%
All Indica  2759 53.90% 45.60% 0.18% 0.00% C: 0.36%
All Japonica  1512 77.50% 18.80% 0.00% 0.00% C: 3.64%
Aus  269 95.90% 3.70% 0.00% 0.00% C: 0.37%
Indica I  595 57.10% 42.70% 0.17% 0.00% NA
Indica II  465 63.70% 36.30% 0.00% 0.00% NA
Indica III  913 46.00% 53.10% 0.11% 0.00% C: 0.77%
Indica Intermediate  786 54.80% 44.40% 0.38% 0.00% C: 0.38%
Temperate Japonica  767 87.40% 12.00% 0.00% 0.00% C: 0.65%
Tropical Japonica  504 67.10% 29.80% 0.00% 0.00% C: 3.17%
Japonica Intermediate  241 68.00% 17.80% 0.00% 0.00% C: 14.11%
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 2.22% 0.00% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210110384 CG -> C LOC_Os12g17640.1 upstream_gene_variant ; 4789.0bp to feature; MODIFIER silent_mutation Average:30.658; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1210110384 CG -> C LOC_Os12g17650.1 downstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:30.658; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1210110384 CG -> C LOC_Os12g17650-LOC_Os12g17660 intergenic_region ; MODIFIER silent_mutation Average:30.658; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1210110384 CG -> GG LOC_Os12g17640.1 upstream_gene_variant ; 4788.0bp to feature; MODIFIER silent_mutation Average:30.658; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1210110384 CG -> GG LOC_Os12g17650.1 downstream_gene_variant ; 711.0bp to feature; MODIFIER silent_mutation Average:30.658; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg1210110384 CG -> GG LOC_Os12g17650-LOC_Os12g17660 intergenic_region ; MODIFIER silent_mutation Average:30.658; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210110384 NA 1.67E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 6.26E-08 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 9.00E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 2.72E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 5.46E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 2.69E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 1.29E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 4.01E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 5.29E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 3.46E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 1.01E-09 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 9.33E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 8.81E-08 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 5.12E-09 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 8.48E-06 mr1236_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 4.20E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 1.18E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 5.54E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 9.33E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 2.43E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 3.23E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 1.43E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 1.96E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 6.99E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 4.39E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 4.39E-06 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 6.17E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 8.30E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 5.59E-07 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 4.83E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210110384 NA 4.43E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251