\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210104964:

Variant ID: vg1210104964 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10104964
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTGGGGGAATTTGAGGACTAGTGGTGGCAGTAGATACAGGGGAATCAAATGTTCTAAAGTGATACAAATAACTAGCATTAGTCATTGGATCTATTCC[T/C]
TGTATCGGGACAATTGCGCCGGTCTGACCGGCCCAGGGCCCGGTCTGACCGGCGTCAGGTTGCACGGTCGAACCGGCCTGAGGGCTGGTCTGACCGGTGG

Reverse complement sequence

CCACCGGTCAGACCAGCCCTCAGGCCGGTTCGACCGTGCAACCTGACGCCGGTCAGACCGGGCCCTGGGCCGGTCAGACCGGCGCAATTGTCCCGATACA[A/G]
GGAATAGATCCAATGACTAATGCTAGTTATTTGTATCACTTTAGAACATTTGATTCCCCTGTATCTACTGCCACCACTAGTCCTCAAATTCCCCCACATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.00% 3.40% 41.85% 25.69% NA
All Indica  2759 5.80% 4.60% 55.82% 33.78% NA
All Japonica  1512 76.80% 0.30% 8.33% 14.55% NA
Aus  269 1.90% 5.90% 77.32% 14.87% NA
Indica I  595 2.70% 1.00% 27.06% 69.24% NA
Indica II  465 12.90% 4.30% 56.13% 26.67% NA
Indica III  913 3.20% 7.10% 78.42% 11.28% NA
Indica Intermediate  786 6.90% 4.70% 51.15% 37.28% NA
Temperate Japonica  767 87.10% 0.50% 7.43% 4.95% NA
Tropical Japonica  504 66.50% 0.20% 8.13% 25.20% NA
Japonica Intermediate  241 65.60% 0.00% 11.62% 22.82% NA
VI/Aromatic  96 7.30% 13.50% 75.00% 4.17% NA
Intermediate  90 43.30% 1.10% 35.56% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210104964 T -> C LOC_Os12g17640.1 synonymous_variant ; p.Gln211Gln; LOW synonymous_codon Average:50.277; most accessible tissue: Minghui63 young leaf, score: 88.753 N N N N
vg1210104964 T -> DEL LOC_Os12g17640.1 N frameshift_variant Average:50.277; most accessible tissue: Minghui63 young leaf, score: 88.753 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1210104964 T C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210104964 NA 8.44E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210104964 NA 1.56E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210104964 NA 2.87E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210104964 NA 4.31E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210104964 4.22E-06 9.11E-08 mr1673 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251