\
| Variant ID: vg1210090906 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 10090906 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGGCACTCTTTAAACCAAAGGTCATGACAACCCACTCAAATAAACCAACAAACCCCGGACACCTAAAAGCCGTCTTGTACATATCCTCTTCTGTCATAAA[A/G]
ATTTGATTGTAGCCGGCATTACCATCTAAGAAGCTAATCACCTTATGACCCAAGGCATCATTAATCATCATGTCGGCTATAGGCATAGGATACTCATCTT
AAGATGAGTATCCTATGCCTATAGCCGACATGATGATTAATGATGCCTTGGGTCATAAGGTGATTAGCTTCTTAGATGGTAATGCCGGCTACAATCAAAT[T/C]
TTTATGACAGAAGAGGATATGTACAAGACGGCTTTTAGGTGTCCGGGGTTTGTTGGTTTATTTGAGTGGGTTGTCATGACCTTTGGTTTAAAGAGTGCCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.50% | 0.20% | 36.54% | 28.78% | NA |
| All Indica | 2759 | 10.30% | 0.30% | 53.72% | 35.74% | NA |
| All Japonica | 1512 | 79.00% | 0.00% | 3.37% | 17.59% | NA |
| Aus | 269 | 23.40% | 0.40% | 49.81% | 26.39% | NA |
| Indica I | 595 | 10.80% | 0.20% | 46.72% | 42.35% | NA |
| Indica II | 465 | 14.60% | 0.00% | 47.96% | 37.42% | NA |
| Indica III | 913 | 5.80% | 0.40% | 63.96% | 29.79% | NA |
| Indica Intermediate | 786 | 12.50% | 0.40% | 50.51% | 36.64% | NA |
| Temperate Japonica | 767 | 88.40% | 0.00% | 1.83% | 9.78% | NA |
| Tropical Japonica | 504 | 68.70% | 0.00% | 5.16% | 26.19% | NA |
| Japonica Intermediate | 241 | 71.00% | 0.00% | 4.56% | 24.48% | NA |
| VI/Aromatic | 96 | 47.90% | 0.00% | 35.42% | 16.67% | NA |
| Intermediate | 90 | 47.80% | 0.00% | 28.89% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1210090906 | A -> DEL | LOC_Os12g17620.1 | N | frameshift_variant | Average:28.056; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| vg1210090906 | A -> G | LOC_Os12g17620.1 | synonymous_variant ; p.Ile586Ile; LOW | synonymous_codon | Average:28.056; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1210090906 | NA | 2.57E-07 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210090906 | NA | 6.88E-06 | mr1577 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210090906 | 4.80E-06 | 1.72E-06 | mr1821 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210090906 | NA | 6.47E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210090906 | NA | 7.43E-08 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210090906 | NA | 7.80E-08 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1210090906 | NA | 4.17E-08 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |