\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210090906:

Variant ID: vg1210090906 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10090906
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCACTCTTTAAACCAAAGGTCATGACAACCCACTCAAATAAACCAACAAACCCCGGACACCTAAAAGCCGTCTTGTACATATCCTCTTCTGTCATAAA[A/G]
ATTTGATTGTAGCCGGCATTACCATCTAAGAAGCTAATCACCTTATGACCCAAGGCATCATTAATCATCATGTCGGCTATAGGCATAGGATACTCATCTT

Reverse complement sequence

AAGATGAGTATCCTATGCCTATAGCCGACATGATGATTAATGATGCCTTGGGTCATAAGGTGATTAGCTTCTTAGATGGTAATGCCGGCTACAATCAAAT[T/C]
TTTATGACAGAAGAGGATATGTACAAGACGGCTTTTAGGTGTCCGGGGTTTGTTGGTTTATTTGAGTGGGTTGTCATGACCTTTGGTTTAAAGAGTGCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.50% 0.20% 36.54% 28.78% NA
All Indica  2759 10.30% 0.30% 53.72% 35.74% NA
All Japonica  1512 79.00% 0.00% 3.37% 17.59% NA
Aus  269 23.40% 0.40% 49.81% 26.39% NA
Indica I  595 10.80% 0.20% 46.72% 42.35% NA
Indica II  465 14.60% 0.00% 47.96% 37.42% NA
Indica III  913 5.80% 0.40% 63.96% 29.79% NA
Indica Intermediate  786 12.50% 0.40% 50.51% 36.64% NA
Temperate Japonica  767 88.40% 0.00% 1.83% 9.78% NA
Tropical Japonica  504 68.70% 0.00% 5.16% 26.19% NA
Japonica Intermediate  241 71.00% 0.00% 4.56% 24.48% NA
VI/Aromatic  96 47.90% 0.00% 35.42% 16.67% NA
Intermediate  90 47.80% 0.00% 28.89% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210090906 A -> DEL LOC_Os12g17620.1 N frameshift_variant Average:28.056; most accessible tissue: Minghui63 flag leaf, score: 64.284 N N N N
vg1210090906 A -> G LOC_Os12g17620.1 synonymous_variant ; p.Ile586Ile; LOW synonymous_codon Average:28.056; most accessible tissue: Minghui63 flag leaf, score: 64.284 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210090906 NA 2.57E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210090906 NA 6.88E-06 mr1577 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210090906 4.80E-06 1.72E-06 mr1821 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210090906 NA 6.47E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210090906 NA 7.43E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210090906 NA 7.80E-08 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210090906 NA 4.17E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251