\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210055718:

Variant ID: vg1210055718 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 10055718
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, T: 0.45, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAGAAATCCTATTAGGGAGTAAATCGAATCATTTTCAATGGACTAAACAATTCTTTTCAACTAGATTGAAACTAAAGGGTTTTCTGGTTGATTTTCA[T/C]
GTGAGAACACTGATTTTAGGTGGTTGCTTTTTTTCTTTTTTTTAGAACTGCATTAATAATCTATTATCTTATTAAAGTAATAGAAAAAAAAGCCACCACG

Reverse complement sequence

CGTGGTGGCTTTTTTTTCTATTACTTTAATAAGATAATAGATTATTAATGCAGTTCTAAAAAAAAGAAAAAAAGCAACCACCTAAAATCAGTGTTCTCAC[A/G]
TGAAAATCAACCAGAAAACCCTTTAGTTTCAATCTAGTTGAAAAGAATTGTTTAGTCCATTGAAAATGATTCGATTTACTCCCTAATAGGATTTCTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 35.80% 3.53% 2.75% NA
All Indica  2759 76.40% 17.30% 4.20% 2.03% NA
All Japonica  1512 23.10% 72.80% 2.84% 1.26% NA
Aus  269 63.20% 18.20% 0.74% 17.84% NA
Indica I  595 82.00% 4.40% 11.93% 1.68% NA
Indica II  465 56.10% 41.30% 2.37% 0.22% NA
Indica III  913 84.70% 12.50% 1.20% 1.64% NA
Indica Intermediate  786 74.70% 18.60% 2.93% 3.82% NA
Temperate Japonica  767 16.90% 81.60% 1.04% 0.39% NA
Tropical Japonica  504 25.60% 67.10% 5.16% 2.18% NA
Japonica Intermediate  241 37.30% 56.80% 3.73% 2.07% NA
VI/Aromatic  96 76.00% 21.90% 0.00% 2.08% NA
Intermediate  90 40.00% 47.80% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1210055718 T -> C LOC_Os12g17530.1 downstream_gene_variant ; 2701.0bp to feature; MODIFIER silent_mutation Average:42.024; most accessible tissue: Callus, score: 68.896 N N N N
vg1210055718 T -> C LOC_Os12g17540.1 downstream_gene_variant ; 518.0bp to feature; MODIFIER silent_mutation Average:42.024; most accessible tissue: Callus, score: 68.896 N N N N
vg1210055718 T -> C LOC_Os12g17550.1 downstream_gene_variant ; 2999.0bp to feature; MODIFIER silent_mutation Average:42.024; most accessible tissue: Callus, score: 68.896 N N N N
vg1210055718 T -> C LOC_Os12g17540-LOC_Os12g17550 intergenic_region ; MODIFIER silent_mutation Average:42.024; most accessible tissue: Callus, score: 68.896 N N N N
vg1210055718 T -> DEL N N silent_mutation Average:42.024; most accessible tissue: Callus, score: 68.896 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1210055718 NA 1.07E-08 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718 NA 1.69E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718 NA 1.04E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718 NA 1.67E-13 mr1002_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718 NA 5.81E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251