Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210055718:

Variant ID: vg1210055718 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10055718
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, T: 0.45, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAAGAAATCCTATTAGGGAGTAAATCGAATCATTTTCAATGGACTAAACAATTCTTTTCAACTAGATTGAAACTAAAGGGTTTTCTGGTTGATTTTCA[T/C]
GTGAGAACACTGATTTTAGGTGGTTGCTTTTTTTCTTTTTTTTAGAACTGCATTAATAATCTATTATCTTATTAAAGTAATAGAAAAAAAAGCCACCACG

Reverse complement sequence

CGTGGTGGCTTTTTTTTCTATTACTTTAATAAGATAATAGATTATTAATGCAGTTCTAAAAAAAAGAAAAAAAGCAACCACCTAAAATCAGTGTTCTCAC[A/G]
TGAAAATCAACCAGAAAACCCTTTAGTTTCAATCTAGTTGAAAAGAATTGTTTAGTCCATTGAAAATGATTCGATTTACTCCCTAATAGGATTTCTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	35.80%	3.53%	2.75%	NA
All Indica	2759	76.40%	17.30%	4.20%	2.03%	NA
All Japonica	1512	23.10%	72.80%	2.84%	1.26%	NA
Aus	269	63.20%	18.20%	0.74%	17.84%	NA
Indica I	595	82.00%	4.40%	11.93%	1.68%	NA
Indica II	465	56.10%	41.30%	2.37%	0.22%	NA
Indica III	913	84.70%	12.50%	1.20%	1.64%	NA
Indica Intermediate	786	74.70%	18.60%	2.93%	3.82%	NA
Temperate Japonica	767	16.90%	81.60%	1.04%	0.39%	NA
Tropical Japonica	504	25.60%	67.10%	5.16%	2.18%	NA
Japonica Intermediate	241	37.30%	56.80%	3.73%	2.07%	NA
VI/Aromatic	96	76.00%	21.90%	0.00%	2.08%	NA
Intermediate	90	40.00%	47.80%	6.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210055718	T -> C	LOC_Os12g17530.1	downstream_gene_variant ; 2701.0bp to feature; MODIFIER	silent_mutation	Average:42.024; most accessible tissue: Callus, score: 68.896	N	N	N	N
vg1210055718	T -> C	LOC_Os12g17540.1	downstream_gene_variant ; 518.0bp to feature; MODIFIER	silent_mutation	Average:42.024; most accessible tissue: Callus, score: 68.896	N	N	N	N
vg1210055718	T -> C	LOC_Os12g17550.1	downstream_gene_variant ; 2999.0bp to feature; MODIFIER	silent_mutation	Average:42.024; most accessible tissue: Callus, score: 68.896	N	N	N	N
vg1210055718	T -> C	LOC_Os12g17540-LOC_Os12g17550	intergenic_region ; MODIFIER	silent_mutation	Average:42.024; most accessible tissue: Callus, score: 68.896	N	N	N	N
vg1210055718	T -> DEL	N	N	silent_mutation	Average:42.024; most accessible tissue: Callus, score: 68.896	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210055718	NA	1.07E-08	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718	NA	1.69E-14	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718	NA	1.04E-11	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718	NA	1.67E-13	mr1002_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210055718	NA	5.81E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251