\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209997382:

Variant ID: vg1209997382 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 9997382
Reference Allele: GAlternative Allele: GTGGTTGATCGTGTTTTATAAACTTGTTGAAACATAAAATCA,A
Primary Allele: GSecondary Allele: GTGGTTGATCGTGTTTTATA AACTTGTTGAAACATAAAAT CA

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CTATATGCATGTCTTTATTCGAGTGCTAAATGATCTACAATATCTAGCATTAAAACAATAACTCCCATCGTGTTTTATAAACTTGTTGAAACATAAAATC[G/GTGGTTGATCGTGTTTTATAAACTTGTTGAAACATAAAATCA,A]
TGGTCACGCACCCCAAGACAAAATAATTCAAAAATCATATAGGTTTTAATTTTTTATCAAAGAGAGTAGTAAATTTATACGGACAATTAATCACATCTTA

Reverse complement sequence

TAAGATGTGATTAATTGTCCGTATAAATTTACTACTCTCTTTGATAAAAAATTAAAACCTATATGATTTTTGAATTATTTTGTCTTGGGGTGCGTGACCA[C/TGATTTTATGTTTCAACAAGTTTATAAAACACGATCAACCAC,T]
GATTTTATGTTTCAACAAGTTTATAAAACACGATGGGAGTTATTGTTTTAATGCTAGATATTGTAGATCATTTAGCACTCGAATAAAGACATGCATATAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GTGGTTGATCGTGTTTTATA AACTTGTTGAAACATAAAAT CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 18.90% 2.16% 0.42% A: 2.26%
All Indica  2759 63.10% 29.80% 3.41% 0.00% A: 3.66%
All Japonica  1512 96.30% 3.20% 0.26% 0.00% A: 0.26%
Aus  269 92.20% 0.40% 0.00% 7.43% NA
Indica I  595 72.90% 19.30% 5.55% 0.00% A: 2.18%
Indica II  465 65.40% 25.80% 3.87% 0.00% A: 4.95%
Indica III  913 55.50% 38.90% 1.86% 0.00% A: 3.72%
Indica Intermediate  786 63.20% 29.50% 3.31% 0.00% A: 3.94%
Temperate Japonica  767 94.00% 5.20% 0.39% 0.00% A: 0.39%
Tropical Japonica  504 98.00% 1.60% 0.20% 0.00% A: 0.20%
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 14.60% 0.00% 0.00% A: 1.04%
Intermediate  90 86.70% 7.80% 4.44% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209997382 G -> DEL N N silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> A LOC_Os12g17424.1 upstream_gene_variant ; 4044.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> A LOC_Os12g17430.1 upstream_gene_variant ; 934.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> A LOC_Os12g17440.1 upstream_gene_variant ; 1418.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> A LOC_Os12g17450.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> A LOC_Os12g17430-LOC_Os12g17440 intergenic_region ; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA LOC_Os12g17424.1 upstream_gene_variant ; 4045.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA LOC_Os12g17430.1 upstream_gene_variant ; 935.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA LOC_Os12g17440.1 upstream_gene_variant ; 1417.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA LOC_Os12g17450.1 upstream_gene_variant ; 2392.0bp to feature; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg1209997382 G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA LOC_Os12g17430-LOC_Os12g17440 intergenic_region ; MODIFIER silent_mutation Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209997382 NA 1.88E-07 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 1.13E-06 mr1042 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 1.37E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 6.86E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 7.73E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 5.77E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 9.76E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 2.74E-06 mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 2.95E-06 NA mr1888 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 1.77E-07 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209997382 NA 4.23E-09 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251