\
| Variant ID: vg1209997382 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 9997382 |
| Reference Allele: G | Alternative Allele: GTGGTTGATCGTGTTTTATAAACTTGTTGAAACATAAAATCA,A |
| Primary Allele: G | Secondary Allele: GTGGTTGATCGTGTTTTATA AACTTGTTGAAACATAAAAT CA |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 104. )
CTATATGCATGTCTTTATTCGAGTGCTAAATGATCTACAATATCTAGCATTAAAACAATAACTCCCATCGTGTTTTATAAACTTGTTGAAACATAAAATC[G/GTGGTTGATCGTGTTTTATAAACTTGTTGAAACATAAAATCA,A]
TGGTCACGCACCCCAAGACAAAATAATTCAAAAATCATATAGGTTTTAATTTTTTATCAAAGAGAGTAGTAAATTTATACGGACAATTAATCACATCTTA
TAAGATGTGATTAATTGTCCGTATAAATTTACTACTCTCTTTGATAAAAAATTAAAACCTATATGATTTTTGAATTATTTTGTCTTGGGGTGCGTGACCA[C/TGATTTTATGTTTCAACAAGTTTATAAAACACGATCAACCAC,T]
GATTTTATGTTTCAACAAGTTTATAAAACACGATGGGAGTTATTGTTTTAATGCTAGATATTGTAGATCATTTAGCACTCGAATAAAGACATGCATATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of GTGGTTGATCGTGTTTTATA AACTTGTTGAAACATAAAAT CA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.30% | 18.90% | 2.16% | 0.42% | A: 2.26% |
| All Indica | 2759 | 63.10% | 29.80% | 3.41% | 0.00% | A: 3.66% |
| All Japonica | 1512 | 96.30% | 3.20% | 0.26% | 0.00% | A: 0.26% |
| Aus | 269 | 92.20% | 0.40% | 0.00% | 7.43% | NA |
| Indica I | 595 | 72.90% | 19.30% | 5.55% | 0.00% | A: 2.18% |
| Indica II | 465 | 65.40% | 25.80% | 3.87% | 0.00% | A: 4.95% |
| Indica III | 913 | 55.50% | 38.90% | 1.86% | 0.00% | A: 3.72% |
| Indica Intermediate | 786 | 63.20% | 29.50% | 3.31% | 0.00% | A: 3.94% |
| Temperate Japonica | 767 | 94.00% | 5.20% | 0.39% | 0.00% | A: 0.39% |
| Tropical Japonica | 504 | 98.00% | 1.60% | 0.20% | 0.00% | A: 0.20% |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 14.60% | 0.00% | 0.00% | A: 1.04% |
| Intermediate | 90 | 86.70% | 7.80% | 4.44% | 0.00% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209997382 | G -> DEL | N | N | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> A | LOC_Os12g17424.1 | upstream_gene_variant ; 4044.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> A | LOC_Os12g17430.1 | upstream_gene_variant ; 934.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> A | LOC_Os12g17440.1 | upstream_gene_variant ; 1418.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> A | LOC_Os12g17450.1 | upstream_gene_variant ; 2393.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> A | LOC_Os12g17430-LOC_Os12g17440 | intergenic_region ; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA | LOC_Os12g17424.1 | upstream_gene_variant ; 4045.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA | LOC_Os12g17430.1 | upstream_gene_variant ; 935.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA | LOC_Os12g17440.1 | upstream_gene_variant ; 1417.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA | LOC_Os12g17450.1 | upstream_gene_variant ; 2392.0bp to feature; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg1209997382 | G -> GTGGTTGATCGTGTTTTATAAACTTGTTGA AACATAAAATCA | LOC_Os12g17430-LOC_Os12g17440 | intergenic_region ; MODIFIER | silent_mutation | Average:47.194; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209997382 | NA | 1.88E-07 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 1.13E-06 | mr1042 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 1.37E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 6.86E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 7.73E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 5.77E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 9.76E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 2.74E-06 | mr1678 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | 2.95E-06 | NA | mr1888 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 1.77E-07 | mr1888 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209997382 | NA | 4.23E-09 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |