Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209953191:

Variant ID: vg1209953191 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9953191
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

TGATGGTGACAGCTCAGTACGAGTATTCCTCCACGTTAGTATATATTCCTAAGAAACTTTCCTAGGAAGGGTACTCCTCCGTATTTAACCCCGGTTGGAT[A/G]
GCCATGACAGGTTATCATAAGGAACTCGACAATCAGGGGTGGCTTCTCAAAACACTAGGAGGGCACTGTTAGGGGTATTGGCTGCATGACTGTATACTAG

Reverse complement sequence

CTAGTATACAGTCATGCAGCCAATACCCCTAACAGTGCCCTCCTAGTGTTTTGAGAAGCCACCCCTGATTGTCGAGTTCCTTATGATAACCTGTCATGGC[T/C]
ATCCAACCGGGGTTAAATACGGAGGAGTACCCTTCCTAGGAAAGTTTCTTAGGAATATATACTAACGTGGAGGAATACTCGTACTGAGCTGTCACCATCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.80%	13.90%	0.53%	56.81%	NA
All Indica	2759	6.70%	21.30%	0.69%	71.22%	NA
All Japonica	1512	73.70%	3.00%	0.20%	23.08%	NA
Aus	269	3.70%	1.50%	0.37%	94.42%	NA
Indica I	595	7.90%	22.40%	0.50%	69.24%	NA
Indica II	465	14.40%	15.50%	0.86%	69.25%	NA
Indica III	913	2.50%	24.40%	0.33%	72.73%	NA
Indica Intermediate	786	6.20%	20.50%	1.15%	72.14%	NA
Temperate Japonica	767	82.50%	2.90%	0.26%	14.34%	NA
Tropical Japonica	504	67.70%	0.20%	0.20%	31.94%	NA
Japonica Intermediate	241	58.10%	9.50%	0.00%	32.37%	NA
VI/Aromatic	96	10.40%	9.40%	0.00%	80.21%	NA
Intermediate	90	43.30%	10.00%	2.22%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209953191	A -> DEL	N	N	silent_mutation	Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1209953191	A -> G	LOC_Os12g17370.1	downstream_gene_variant ; 4434.0bp to feature; MODIFIER	silent_mutation	Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1209953191	A -> G	LOC_Os12g17370-LOC_Os12g17390	intergenic_region ; MODIFIER	silent_mutation	Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209953191	3.42E-06	3.43E-06	mr1173	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191	NA	8.02E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191	7.56E-08	3.67E-08	mr1337	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191	NA	3.66E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191	6.67E-06	6.68E-06	mr1381	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191	NA	2.78E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191	NA	3.86E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251