\
| Variant ID: vg1209953191 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9953191 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 54. )
TGATGGTGACAGCTCAGTACGAGTATTCCTCCACGTTAGTATATATTCCTAAGAAACTTTCCTAGGAAGGGTACTCCTCCGTATTTAACCCCGGTTGGAT[A/G]
GCCATGACAGGTTATCATAAGGAACTCGACAATCAGGGGTGGCTTCTCAAAACACTAGGAGGGCACTGTTAGGGGTATTGGCTGCATGACTGTATACTAG
CTAGTATACAGTCATGCAGCCAATACCCCTAACAGTGCCCTCCTAGTGTTTTGAGAAGCCACCCCTGATTGTCGAGTTCCTTATGATAACCTGTCATGGC[T/C]
ATCCAACCGGGGTTAAATACGGAGGAGTACCCTTCCTAGGAAAGTTTCTTAGGAATATATACTAACGTGGAGGAATACTCGTACTGAGCTGTCACCATCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.80% | 13.90% | 0.53% | 56.81% | NA |
| All Indica | 2759 | 6.70% | 21.30% | 0.69% | 71.22% | NA |
| All Japonica | 1512 | 73.70% | 3.00% | 0.20% | 23.08% | NA |
| Aus | 269 | 3.70% | 1.50% | 0.37% | 94.42% | NA |
| Indica I | 595 | 7.90% | 22.40% | 0.50% | 69.24% | NA |
| Indica II | 465 | 14.40% | 15.50% | 0.86% | 69.25% | NA |
| Indica III | 913 | 2.50% | 24.40% | 0.33% | 72.73% | NA |
| Indica Intermediate | 786 | 6.20% | 20.50% | 1.15% | 72.14% | NA |
| Temperate Japonica | 767 | 82.50% | 2.90% | 0.26% | 14.34% | NA |
| Tropical Japonica | 504 | 67.70% | 0.20% | 0.20% | 31.94% | NA |
| Japonica Intermediate | 241 | 58.10% | 9.50% | 0.00% | 32.37% | NA |
| VI/Aromatic | 96 | 10.40% | 9.40% | 0.00% | 80.21% | NA |
| Intermediate | 90 | 43.30% | 10.00% | 2.22% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209953191 | A -> DEL | N | N | silent_mutation | Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg1209953191 | A -> G | LOC_Os12g17370.1 | downstream_gene_variant ; 4434.0bp to feature; MODIFIER | silent_mutation | Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg1209953191 | A -> G | LOC_Os12g17370-LOC_Os12g17390 | intergenic_region ; MODIFIER | silent_mutation | Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209953191 | 3.42E-06 | 3.43E-06 | mr1173 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209953191 | NA | 8.02E-06 | mr1177 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209953191 | 7.56E-08 | 3.67E-08 | mr1337 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209953191 | NA | 3.66E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209953191 | 6.67E-06 | 6.68E-06 | mr1381 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209953191 | NA | 2.78E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209953191 | NA | 3.86E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |