\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209953191:

Variant ID: vg1209953191 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9953191
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


TGATGGTGACAGCTCAGTACGAGTATTCCTCCACGTTAGTATATATTCCTAAGAAACTTTCCTAGGAAGGGTACTCCTCCGTATTTAACCCCGGTTGGAT[A/G]
GCCATGACAGGTTATCATAAGGAACTCGACAATCAGGGGTGGCTTCTCAAAACACTAGGAGGGCACTGTTAGGGGTATTGGCTGCATGACTGTATACTAG

Reverse complement sequence

CTAGTATACAGTCATGCAGCCAATACCCCTAACAGTGCCCTCCTAGTGTTTTGAGAAGCCACCCCTGATTGTCGAGTTCCTTATGATAACCTGTCATGGC[T/C]
ATCCAACCGGGGTTAAATACGGAGGAGTACCCTTCCTAGGAAAGTTTCTTAGGAATATATACTAACGTGGAGGAATACTCGTACTGAGCTGTCACCATCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 13.90% 0.53% 56.81% NA
All Indica  2759 6.70% 21.30% 0.69% 71.22% NA
All Japonica  1512 73.70% 3.00% 0.20% 23.08% NA
Aus  269 3.70% 1.50% 0.37% 94.42% NA
Indica I  595 7.90% 22.40% 0.50% 69.24% NA
Indica II  465 14.40% 15.50% 0.86% 69.25% NA
Indica III  913 2.50% 24.40% 0.33% 72.73% NA
Indica Intermediate  786 6.20% 20.50% 1.15% 72.14% NA
Temperate Japonica  767 82.50% 2.90% 0.26% 14.34% NA
Tropical Japonica  504 67.70% 0.20% 0.20% 31.94% NA
Japonica Intermediate  241 58.10% 9.50% 0.00% 32.37% NA
VI/Aromatic  96 10.40% 9.40% 0.00% 80.21% NA
Intermediate  90 43.30% 10.00% 2.22% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209953191 A -> DEL N N silent_mutation Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1209953191 A -> G LOC_Os12g17370.1 downstream_gene_variant ; 4434.0bp to feature; MODIFIER silent_mutation Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1209953191 A -> G LOC_Os12g17370-LOC_Os12g17390 intergenic_region ; MODIFIER silent_mutation Average:38.935; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209953191 3.42E-06 3.43E-06 mr1173 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191 NA 8.02E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191 7.56E-08 3.67E-08 mr1337 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191 NA 3.66E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191 6.67E-06 6.68E-06 mr1381 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191 NA 2.78E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209953191 NA 3.86E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251