\
| Variant ID: vg1209951898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9951898 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.02, others allele: 0.00, population size: 53. )
TGGTTTAGCGCATGATTAATTAGTATTAGCTAAAAAATCTTGAAAAATAGAATGATATGATTTTTAAGGTAGCTTTTGTATACAAAACTTTTGAAAGAAA[T/A]
GACAAAATTTGCTACAAGACACTCAAAGAATATAGTCTTTGTTGCGGGACACCTTAAGAATGTGAATTTGCTCAAGGACACTAAAAAAATATGGTAATTT
AAATTACCATATTTTTTTAGTGTCCTTGAGCAAATTCACATTCTTAAGGTGTCCCGCAACAAAGACTATATTCTTTGAGTGTCTTGTAGCAAATTTTGTC[A/T]
TTTCTTTCAAAAGTTTTGTATACAAAAGCTACCTTAAAAATCATATCATTCTATTTTTCAAGATTTTTTAGCTAATACTAATTAATCATGCGCTAAACCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.70% | 13.80% | 0.55% | 56.90% | NA |
| All Indica | 2759 | 6.60% | 21.30% | 0.69% | 71.40% | NA |
| All Japonica | 1512 | 73.70% | 3.00% | 0.26% | 22.95% | NA |
| Aus | 269 | 4.10% | 1.50% | 0.37% | 94.05% | NA |
| Indica I | 595 | 7.90% | 22.70% | 0.50% | 68.91% | NA |
| Indica II | 465 | 14.60% | 15.30% | 1.29% | 68.82% | NA |
| Indica III | 913 | 2.20% | 24.40% | 0.22% | 73.17% | NA |
| Indica Intermediate | 786 | 6.10% | 20.10% | 1.02% | 72.77% | NA |
| Temperate Japonica | 767 | 82.50% | 2.90% | 0.26% | 14.34% | NA |
| Tropical Japonica | 504 | 67.90% | 0.20% | 0.20% | 31.75% | NA |
| Japonica Intermediate | 241 | 58.10% | 9.50% | 0.41% | 31.95% | NA |
| VI/Aromatic | 96 | 9.40% | 9.40% | 1.04% | 80.21% | NA |
| Intermediate | 90 | 43.30% | 8.90% | 1.11% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209951898 | T -> DEL | N | N | silent_mutation | Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727 | N | N | N | N |
| vg1209951898 | T -> A | LOC_Os12g17370.1 | downstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727 | N | N | N | N |
| vg1209951898 | T -> A | LOC_Os12g17370-LOC_Os12g17390 | intergenic_region ; MODIFIER | silent_mutation | Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209951898 | 3.62E-06 | 3.62E-06 | mr1173 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | NA | 4.92E-06 | mr1177 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | NA | 8.70E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | 5.81E-07 | 4.27E-07 | mr1337 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | NA | 7.40E-07 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | NA | 6.55E-06 | mr1499_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | NA | 6.31E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | NA | 7.04E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209951898 | NA | 3.17E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |