Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209951898:

Variant ID: vg1209951898 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9951898
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTTTAGCGCATGATTAATTAGTATTAGCTAAAAAATCTTGAAAAATAGAATGATATGATTTTTAAGGTAGCTTTTGTATACAAAACTTTTGAAAGAAA[T/A]
GACAAAATTTGCTACAAGACACTCAAAGAATATAGTCTTTGTTGCGGGACACCTTAAGAATGTGAATTTGCTCAAGGACACTAAAAAAATATGGTAATTT

Reverse complement sequence

AAATTACCATATTTTTTTAGTGTCCTTGAGCAAATTCACATTCTTAAGGTGTCCCGCAACAAAGACTATATTCTTTGAGTGTCTTGTAGCAAATTTTGTC[A/T]
TTTCTTTCAAAAGTTTTGTATACAAAAGCTACCTTAAAAATCATATCATTCTATTTTTCAAGATTTTTTAGCTAATACTAATTAATCATGCGCTAAACCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.70%	13.80%	0.55%	56.90%	NA
All Indica	2759	6.60%	21.30%	0.69%	71.40%	NA
All Japonica	1512	73.70%	3.00%	0.26%	22.95%	NA
Aus	269	4.10%	1.50%	0.37%	94.05%	NA
Indica I	595	7.90%	22.70%	0.50%	68.91%	NA
Indica II	465	14.60%	15.30%	1.29%	68.82%	NA
Indica III	913	2.20%	24.40%	0.22%	73.17%	NA
Indica Intermediate	786	6.10%	20.10%	1.02%	72.77%	NA
Temperate Japonica	767	82.50%	2.90%	0.26%	14.34%	NA
Tropical Japonica	504	67.90%	0.20%	0.20%	31.75%	NA
Japonica Intermediate	241	58.10%	9.50%	0.41%	31.95%	NA
VI/Aromatic	96	9.40%	9.40%	1.04%	80.21%	NA
Intermediate	90	43.30%	8.90%	1.11%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209951898	T -> DEL	N	N	silent_mutation	Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727	N	N	N	N
vg1209951898	T -> A	LOC_Os12g17370.1	downstream_gene_variant ; 3141.0bp to feature; MODIFIER	silent_mutation	Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727	N	N	N	N
vg1209951898	T -> A	LOC_Os12g17370-LOC_Os12g17390	intergenic_region ; MODIFIER	silent_mutation	Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209951898	3.62E-06	3.62E-06	mr1173	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	NA	4.92E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	NA	8.70E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	5.81E-07	4.27E-07	mr1337	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	NA	7.40E-07	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	NA	6.55E-06	mr1499_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	NA	6.31E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	NA	7.04E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898	NA	3.17E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251