\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209951898:

Variant ID: vg1209951898 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9951898
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTTTAGCGCATGATTAATTAGTATTAGCTAAAAAATCTTGAAAAATAGAATGATATGATTTTTAAGGTAGCTTTTGTATACAAAACTTTTGAAAGAAA[T/A]
GACAAAATTTGCTACAAGACACTCAAAGAATATAGTCTTTGTTGCGGGACACCTTAAGAATGTGAATTTGCTCAAGGACACTAAAAAAATATGGTAATTT

Reverse complement sequence

AAATTACCATATTTTTTTAGTGTCCTTGAGCAAATTCACATTCTTAAGGTGTCCCGCAACAAAGACTATATTCTTTGAGTGTCTTGTAGCAAATTTTGTC[A/T]
TTTCTTTCAAAAGTTTTGTATACAAAAGCTACCTTAAAAATCATATCATTCTATTTTTCAAGATTTTTTAGCTAATACTAATTAATCATGCGCTAAACCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 13.80% 0.55% 56.90% NA
All Indica  2759 6.60% 21.30% 0.69% 71.40% NA
All Japonica  1512 73.70% 3.00% 0.26% 22.95% NA
Aus  269 4.10% 1.50% 0.37% 94.05% NA
Indica I  595 7.90% 22.70% 0.50% 68.91% NA
Indica II  465 14.60% 15.30% 1.29% 68.82% NA
Indica III  913 2.20% 24.40% 0.22% 73.17% NA
Indica Intermediate  786 6.10% 20.10% 1.02% 72.77% NA
Temperate Japonica  767 82.50% 2.90% 0.26% 14.34% NA
Tropical Japonica  504 67.90% 0.20% 0.20% 31.75% NA
Japonica Intermediate  241 58.10% 9.50% 0.41% 31.95% NA
VI/Aromatic  96 9.40% 9.40% 1.04% 80.21% NA
Intermediate  90 43.30% 8.90% 1.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209951898 T -> DEL N N silent_mutation Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg1209951898 T -> A LOC_Os12g17370.1 downstream_gene_variant ; 3141.0bp to feature; MODIFIER silent_mutation Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg1209951898 T -> A LOC_Os12g17370-LOC_Os12g17390 intergenic_region ; MODIFIER silent_mutation Average:35.51; most accessible tissue: Minghui63 flower, score: 58.727 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209951898 3.62E-06 3.62E-06 mr1173 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 NA 4.92E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 NA 8.70E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 5.81E-07 4.27E-07 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 NA 7.40E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 NA 6.55E-06 mr1499_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 NA 6.31E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 NA 7.04E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951898 NA 3.17E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251