Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209951727:

Variant ID: vg1209951727 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9951727
Reference Allele: A	Alternative Allele: C,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGCGATTATATCAGCGAGATGCTAAAAAAAATCTACAAATTCTTACTCTTCTTCTACTTTGGTCTACAGTAACGTATTATGCAACCCCTCCTGCTATA[A/C,T]
AGTAGTCTTAAAGCTGTGTTCGCTAGTTGAAGTTGGGAACACTTCTCTCATTGCACGCAAAATGAAATGATGGTTTAGCGCATGATTAATTAGTATTAGC

Reverse complement sequence

GCTAATACTAATTAATCATGCGCTAAACCATCATTTCATTTTGCGTGCAATGAGAGAAGTGTTCCCAACTTCAACTAGCGAACACAGCTTTAAGACTACT[T/G,A]
TATAGCAGGAGGGGTTGCATAATACGTTACTGTAGACCAAAGTAGAAGAAGAGTAAGAATTTGTAGATTTTTTTTAGCATCTCGCTGATATAATCGCGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.50%	13.90%	0.68%	56.90%	T: 0.08%
All Indica	2759	6.40%	21.30%	0.80%	71.44%	T: 0.07%
All Japonica	1512	73.50%	3.20%	0.46%	22.88%	NA
Aus	269	3.70%	1.90%	0.74%	93.68%	NA
Indica I	595	7.40%	22.90%	0.50%	69.24%	NA
Indica II	465	14.20%	15.30%	1.29%	69.25%	NA
Indica III	913	2.10%	24.60%	0.33%	72.95%	NA
Indica Intermediate	786	6.00%	19.80%	1.27%	72.65%	T: 0.25%
Temperate Japonica	767	82.10%	3.10%	0.65%	14.08%	NA
Tropical Japonica	504	67.70%	0.20%	0.20%	31.94%	NA
Japonica Intermediate	241	58.10%	9.50%	0.41%	31.95%	NA
VI/Aromatic	96	9.40%	9.40%	0.00%	81.25%	NA
Intermediate	90	43.30%	6.70%	1.11%	46.67%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209951727	A -> C	LOC_Os12g17370.1	downstream_gene_variant ; 2970.0bp to feature; MODIFIER	silent_mutation	Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N
vg1209951727	A -> C	LOC_Os12g17370-LOC_Os12g17390	intergenic_region ; MODIFIER	silent_mutation	Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N
vg1209951727	A -> DEL	N	N	silent_mutation	Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N
vg1209951727	A -> T	LOC_Os12g17370.1	downstream_gene_variant ; 2970.0bp to feature; MODIFIER	silent_mutation	Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N
vg1209951727	A -> T	LOC_Os12g17370-LOC_Os12g17390	intergenic_region ; MODIFIER	silent_mutation	Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209951727	2.69E-06	5.30E-07	mr1337	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	1.71E-06	3.40E-07	mr1312_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	9.07E-07	9.07E-07	mr1312_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	9.09E-06	2.95E-07	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	NA	7.00E-06	mr1417_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	4.59E-06	4.58E-06	mr1651_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	NA	2.36E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	NA	8.61E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	NA	2.36E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	3.20E-06	1.99E-06	mr1832_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	9.01E-06	9.01E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	2.15E-06	8.45E-07	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	6.04E-06	6.04E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	9.22E-06	NA	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727	2.73E-06	2.74E-06	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251