\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209951727:

Variant ID: vg1209951727 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9951727
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGCGATTATATCAGCGAGATGCTAAAAAAAATCTACAAATTCTTACTCTTCTTCTACTTTGGTCTACAGTAACGTATTATGCAACCCCTCCTGCTATA[A/C,T]
AGTAGTCTTAAAGCTGTGTTCGCTAGTTGAAGTTGGGAACACTTCTCTCATTGCACGCAAAATGAAATGATGGTTTAGCGCATGATTAATTAGTATTAGC

Reverse complement sequence

GCTAATACTAATTAATCATGCGCTAAACCATCATTTCATTTTGCGTGCAATGAGAGAAGTGTTCCCAACTTCAACTAGCGAACACAGCTTTAAGACTACT[T/G,A]
TATAGCAGGAGGGGTTGCATAATACGTTACTGTAGACCAAAGTAGAAGAAGAGTAAGAATTTGTAGATTTTTTTTAGCATCTCGCTGATATAATCGCGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.50% 13.90% 0.68% 56.90% T: 0.08%
All Indica  2759 6.40% 21.30% 0.80% 71.44% T: 0.07%
All Japonica  1512 73.50% 3.20% 0.46% 22.88% NA
Aus  269 3.70% 1.90% 0.74% 93.68% NA
Indica I  595 7.40% 22.90% 0.50% 69.24% NA
Indica II  465 14.20% 15.30% 1.29% 69.25% NA
Indica III  913 2.10% 24.60% 0.33% 72.95% NA
Indica Intermediate  786 6.00% 19.80% 1.27% 72.65% T: 0.25%
Temperate Japonica  767 82.10% 3.10% 0.65% 14.08% NA
Tropical Japonica  504 67.70% 0.20% 0.20% 31.94% NA
Japonica Intermediate  241 58.10% 9.50% 0.41% 31.95% NA
VI/Aromatic  96 9.40% 9.40% 0.00% 81.25% NA
Intermediate  90 43.30% 6.70% 1.11% 46.67% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209951727 A -> C LOC_Os12g17370.1 downstream_gene_variant ; 2970.0bp to feature; MODIFIER silent_mutation Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg1209951727 A -> C LOC_Os12g17370-LOC_Os12g17390 intergenic_region ; MODIFIER silent_mutation Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg1209951727 A -> DEL N N silent_mutation Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg1209951727 A -> T LOC_Os12g17370.1 downstream_gene_variant ; 2970.0bp to feature; MODIFIER silent_mutation Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976 N N N N
vg1209951727 A -> T LOC_Os12g17370-LOC_Os12g17390 intergenic_region ; MODIFIER silent_mutation Average:44.023; most accessible tissue: Minghui63 flower, score: 74.976 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209951727 2.69E-06 5.30E-07 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 1.71E-06 3.40E-07 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 9.07E-07 9.07E-07 mr1312_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 9.09E-06 2.95E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 NA 7.00E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 4.59E-06 4.58E-06 mr1651_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 NA 2.36E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 NA 8.61E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 NA 2.36E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 3.20E-06 1.99E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 9.01E-06 9.01E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 2.15E-06 8.45E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 6.04E-06 6.04E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 9.22E-06 NA mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209951727 2.73E-06 2.74E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251