\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209946610:

Variant ID: vg1209946610 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9946610
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGATGCGCCTGGACCGTCTACAGCACGCCCCTGTTGCCGTACTGTTGACATCATCTCTTTTGTCTCGTTGTATTAGCGACCCCCTTTATAAGCTAGC[A/G]
CCGCCGCAATGTCTGTATCGAACAATTGAACCCTAAATTACTTTACTCTTGTCTTGCGGTGCCCATCTATTTCCTTATACTGTTTACTCTTCAATTCAGT

Reverse complement sequence

ACTGAATTGAAGAGTAAACAGTATAAGGAAATAGATGGGCACCGCAAGACAAGAGTAAAGTAATTTAGGGTTCAATTGTTCGATACAGACATTGCGGCGG[T/C]
GCTAGCTTATAAAGGGGGTCGCTAATACAACGAGACAAAAGAGATGATGTCAACAGTACGGCAACAGGGGCGTGCTGTAGACGGTCCAGGCGCATCTCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 13.90% 0.44% 56.90% NA
All Indica  2759 6.70% 21.30% 0.72% 71.26% NA
All Japonica  1512 73.90% 3.10% 0.00% 23.02% NA
Aus  269 3.70% 1.50% 0.00% 94.80% NA
Indica I  595 6.70% 23.00% 1.01% 69.24% NA
Indica II  465 15.10% 15.50% 0.86% 68.60% NA
Indica III  913 2.40% 24.40% 0.11% 73.06% NA
Indica Intermediate  786 6.60% 20.00% 1.15% 72.26% NA
Temperate Japonica  767 82.50% 3.00% 0.00% 14.47% NA
Tropical Japonica  504 68.10% 0.20% 0.00% 31.75% NA
Japonica Intermediate  241 58.50% 9.50% 0.00% 31.95% NA
VI/Aromatic  96 9.40% 9.40% 0.00% 81.25% NA
Intermediate  90 43.30% 8.90% 1.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209946610 A -> DEL N N silent_mutation Average:58.895; most accessible tissue: Minghui63 young leaf, score: 97.701 N N N N
vg1209946610 A -> G LOC_Os12g17370.1 upstream_gene_variant ; 292.0bp to feature; MODIFIER silent_mutation Average:58.895; most accessible tissue: Minghui63 young leaf, score: 97.701 N N N N
vg1209946610 A -> G LOC_Os12g17360.1 downstream_gene_variant ; 1967.0bp to feature; MODIFIER silent_mutation Average:58.895; most accessible tissue: Minghui63 young leaf, score: 97.701 N N N N
vg1209946610 A -> G LOC_Os12g17360-LOC_Os12g17370 intergenic_region ; MODIFIER silent_mutation Average:58.895; most accessible tissue: Minghui63 young leaf, score: 97.701 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209946610 A G 0.0 0.03 0.02 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209946610 NA 3.85E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 3.90E-06 7.40E-07 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 6.18E-07 9.73E-08 mr1312_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 3.43E-06 3.43E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 3.17E-06 9.55E-08 mr1371_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 5.43E-06 1.04E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 9.08E-06 9.09E-06 mr1688_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 NA 9.37E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 6.19E-06 7.70E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 2.88E-06 1.64E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 1.48E-06 5.53E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 8.67E-06 8.67E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 7.09E-06 7.59E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209946610 2.04E-06 2.04E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251