\
| Variant ID: vg1209942861 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9942861 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGGGGACGTCCAGAGCGGATAAGGCCTTGTCGGATCATGCAGAGACAAACTACCATGTAAGATCT[G/A]
GTCATGTAAGAGTTCTCACCGTGCGTATTAACCAAGCCGTTTAATCGGAAATTGGGTTTTTCAACTTCACGGCTGGGGGCTAGGGTAAGCGTTTTTTCAA
TTGAAAAAACGCTTACCCTAGCCCCCAGCCGTGAAGTTGAAAAACCCAATTTCCGATTAAACGGCTTGGTTAATACGCACGGTGAGAACTCTTACATGAC[C/T]
AGATCTTACATGGTAGTTTGTCTCTGCATGATCCGACAAGGCCTTATCCGCTCTGGACGTCCCCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.20% | 0.10% | 6.86% | 23.87% | NA |
| All Indica | 2759 | 67.90% | 0.20% | 10.18% | 21.75% | NA |
| All Japonica | 1512 | 80.90% | 0.00% | 1.72% | 17.39% | NA |
| Aus | 269 | 28.30% | 0.00% | 3.35% | 68.40% | NA |
| Indica I | 595 | 76.80% | 0.30% | 8.40% | 14.45% | NA |
| Indica II | 465 | 65.60% | 0.40% | 13.98% | 20.00% | NA |
| Indica III | 913 | 63.90% | 0.00% | 10.51% | 25.63% | NA |
| Indica Intermediate | 786 | 67.20% | 0.10% | 8.91% | 23.79% | NA |
| Temperate Japonica | 767 | 86.40% | 0.00% | 0.91% | 12.65% | NA |
| Tropical Japonica | 504 | 75.60% | 0.00% | 1.59% | 22.82% | NA |
| Japonica Intermediate | 241 | 74.30% | 0.00% | 4.56% | 21.16% | NA |
| VI/Aromatic | 96 | 30.20% | 0.00% | 7.29% | 62.50% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 1.11% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209942861 | G -> DEL | N | N | silent_mutation | Average:36.713; most accessible tissue: Minghui63 flag leaf, score: 77.494 | N | N | N | N |
| vg1209942861 | G -> A | LOC_Os12g17370.1 | upstream_gene_variant ; 4041.0bp to feature; MODIFIER | silent_mutation | Average:36.713; most accessible tissue: Minghui63 flag leaf, score: 77.494 | N | N | N | N |
| vg1209942861 | G -> A | LOC_Os12g17360.1 | intron_variant ; MODIFIER | silent_mutation | Average:36.713; most accessible tissue: Minghui63 flag leaf, score: 77.494 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209942861 | 1.04E-07 | NA | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 6.93E-09 | 3.72E-11 | mr1538 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 2.06E-08 | 8.51E-13 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 5.04E-07 | 2.31E-10 | mr1547 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 9.25E-16 | 4.99E-24 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 1.02E-12 | 1.76E-21 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 7.65E-06 | 8.92E-09 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 6.58E-06 | 1.48E-10 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | NA | 5.74E-10 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 4.26E-11 | 2.64E-35 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209942861 | 1.13E-07 | 6.37E-26 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |