\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209942861:

Variant ID: vg1209942861 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9942861
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAAGGCCTCTGAGGAACCTAAGGGAACTTCGGCTGGGGACGTCCAGAGCGGATAAGGCCTTGTCGGATCATGCAGAGACAAACTACCATGTAAGATCT[G/A]
GTCATGTAAGAGTTCTCACCGTGCGTATTAACCAAGCCGTTTAATCGGAAATTGGGTTTTTCAACTTCACGGCTGGGGGCTAGGGTAAGCGTTTTTTCAA

Reverse complement sequence

TTGAAAAAACGCTTACCCTAGCCCCCAGCCGTGAAGTTGAAAAACCCAATTTCCGATTAAACGGCTTGGTTAATACGCACGGTGAGAACTCTTACATGAC[C/T]
AGATCTTACATGGTAGTTTGTCTCTGCATGATCCGACAAGGCCTTATCCGCTCTGGACGTCCCCAGCCGAAGTTCCCTTAGGTTCCTCAGAGGCCTTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 0.10% 6.86% 23.87% NA
All Indica  2759 67.90% 0.20% 10.18% 21.75% NA
All Japonica  1512 80.90% 0.00% 1.72% 17.39% NA
Aus  269 28.30% 0.00% 3.35% 68.40% NA
Indica I  595 76.80% 0.30% 8.40% 14.45% NA
Indica II  465 65.60% 0.40% 13.98% 20.00% NA
Indica III  913 63.90% 0.00% 10.51% 25.63% NA
Indica Intermediate  786 67.20% 0.10% 8.91% 23.79% NA
Temperate Japonica  767 86.40% 0.00% 0.91% 12.65% NA
Tropical Japonica  504 75.60% 0.00% 1.59% 22.82% NA
Japonica Intermediate  241 74.30% 0.00% 4.56% 21.16% NA
VI/Aromatic  96 30.20% 0.00% 7.29% 62.50% NA
Intermediate  90 75.60% 0.00% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209942861 G -> DEL N N silent_mutation Average:36.713; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg1209942861 G -> A LOC_Os12g17370.1 upstream_gene_variant ; 4041.0bp to feature; MODIFIER silent_mutation Average:36.713; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg1209942861 G -> A LOC_Os12g17360.1 intron_variant ; MODIFIER silent_mutation Average:36.713; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209942861 1.04E-07 NA mr1538 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 6.93E-09 3.72E-11 mr1538 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 2.06E-08 8.51E-13 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 5.04E-07 2.31E-10 mr1547 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 9.25E-16 4.99E-24 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 1.02E-12 1.76E-21 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 7.65E-06 8.92E-09 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 6.58E-06 1.48E-10 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 NA 5.74E-10 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 4.26E-11 2.64E-35 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209942861 1.13E-07 6.37E-26 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251