| Variant ID: vg1209921454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9921454 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 245. )
TCGTGATTTTCGGCACTTTCCAGAAATTTTGAAAGATTTTGACTGGATTTGAAAAAACTTTGACCAAATTCCACAAAAAATTGAGAAAACCCGAAAATTT[C/T]
GGTCAGTATATTGATTGCCGGTGGGGTCCGAAATTTCGAACCGAATTGTAAACACTGGTATATCCATTTAGAGATATAGAGGCCAGATTTCTATCCATTA
TAATGGATAGAAATCTGGCCTCTATATCTCTAAATGGATATACCAGTGTTTACAATTCGGTTCGAAATTTCGGACCCCACCGGCAATCAATATACTGACC[G/A]
AAATTTTCGGGTTTTCTCAATTTTTTGTGGAATTTGGTCAAAGTTTTTTCAAATCCAGTCAAAATCTTTCAAAATTTCTGGAAAGTGCCGAAAATCACGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.10% | 6.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 23.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209921454 | C -> T | LOC_Os12g17330.1 | downstream_gene_variant ; 4301.0bp to feature; MODIFIER | silent_mutation | Average:52.684; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg1209921454 | C -> T | LOC_Os12g17320.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.684; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209921454 | NA | 1.83E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | NA | 4.07E-06 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | 6.06E-07 | 3.61E-07 | mr1100 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | NA | 6.71E-07 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | 1.14E-06 | 1.14E-06 | mr1141 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | 8.86E-06 | 8.00E-07 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | NA | 3.70E-06 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | NA | 9.87E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | 1.74E-06 | 3.26E-07 | mr1395 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209921454 | 1.01E-09 | 1.34E-09 | mr1613 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/