Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209921454:

Variant ID: vg1209921454 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9921454
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTGATTTTCGGCACTTTCCAGAAATTTTGAAAGATTTTGACTGGATTTGAAAAAACTTTGACCAAATTCCACAAAAAATTGAGAAAACCCGAAAATTT[C/T]
GGTCAGTATATTGATTGCCGGTGGGGTCCGAAATTTCGAACCGAATTGTAAACACTGGTATATCCATTTAGAGATATAGAGGCCAGATTTCTATCCATTA

Reverse complement sequence

TAATGGATAGAAATCTGGCCTCTATATCTCTAAATGGATATACCAGTGTTTACAATTCGGTTCGAAATTTCGGACCCCACCGGCAATCAATATACTGACC[G/A]
AAATTTTCGGGTTTTCTCAATTTTTTGTGGAATTTGGTCAAAGTTTTTTCAAATCCAGTCAAAATCTTTCAAAATTTCTGGAAAGTGCCGAAAATCACGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	3.90%	0.02%	0.00%	NA
All Indica	2759	97.20%	2.80%	0.00%	0.00%	NA
All Japonica	1512	93.10%	6.90%	0.07%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.40%	0.00%	0.00%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	75.90%	23.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209921454	C -> T	LOC_Os12g17330.1	downstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:52.684; most accessible tissue: Minghui63 flag leaf, score: 79.962	N	N	N	N
vg1209921454	C -> T	LOC_Os12g17320.1	intron_variant ; MODIFIER	silent_mutation	Average:52.684; most accessible tissue: Minghui63 flag leaf, score: 79.962	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209921454	NA	1.83E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	NA	4.07E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	6.06E-07	3.61E-07	mr1100	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	NA	6.71E-07	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	1.14E-06	1.14E-06	mr1141	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	8.86E-06	8.00E-07	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	NA	3.70E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	NA	9.87E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	1.74E-06	3.26E-07	mr1395	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	1.01E-09	1.34E-09	mr1613	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	NA	1.23E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	9.41E-07	3.01E-07	mr1619	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	NA	5.77E-08	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209921454	2.85E-07	4.49E-07	mr1962	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251