\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209907443:

Variant ID: vg1209907443 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9907443
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACGGGCCCACCTGTCAGGAGACAACACGTGGGCCCACCCCACGCCATTGAACCCTTCTATTGGATGCCCGGAAAATACGTGCGCCCCACCAACTGACTC[A/G]
CATCTTTCCCCCTCCCCCTCGCCCCCCGCAACGCACGTTCCTTTCCGACCGATCCACCGATCGGAAACCACGCCCTAACCCCAGCAAACCCCAACGCCCC

Reverse complement sequence

GGGGCGTTGGGGTTTGCTGGGGTTAGGGCGTGGTTTCCGATCGGTGGATCGGTCGGAAAGGAACGTGCGTTGCGGGGGGCGAGGGGGAGGGGGAAAGATG[T/C]
GAGTCAGTTGGTGGGGCGCACGTATTTTCCGGGCATCCAATAGAAGGGTTCAATGGCGTGGGGTGGGCCCACGTGTTGTCTCCTGACAGGTGGGCCCGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.20% 0.42% 0.00% NA
All Indica  2759 98.50% 1.40% 0.14% 0.00% NA
All Japonica  1512 95.80% 4.20% 0.07% 0.00% NA
Aus  269 29.00% 66.90% 4.09% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 98.50% 1.40% 0.11% 0.00% NA
Indica Intermediate  786 97.70% 1.90% 0.38% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.40% 0.41% 0.00% NA
VI/Aromatic  96 47.90% 49.00% 3.12% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209907443 A -> G LOC_Os12g17300.1 upstream_gene_variant ; 3431.0bp to feature; MODIFIER silent_mutation Average:99.272; most accessible tissue: Minghui63 root, score: 99.814 N N N N
vg1209907443 A -> G LOC_Os12g17310.1 upstream_gene_variant ; 40.0bp to feature; MODIFIER silent_mutation Average:99.272; most accessible tissue: Minghui63 root, score: 99.814 N N N N
vg1209907443 A -> G LOC_Os12g17300-LOC_Os12g17310 intergenic_region ; MODIFIER silent_mutation Average:99.272; most accessible tissue: Minghui63 root, score: 99.814 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209907443 A G -0.01 0.02 0.04 -0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209907443 NA 1.49E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 2.35E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 6.76E-07 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 1.02E-07 NA mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 1.52E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 2.43E-07 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 2.13E-07 NA mr1395 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 NA 7.96E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 4.87E-07 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 5.75E-07 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 5.64E-08 NA mr1071_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 1.54E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 1.62E-09 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 4.08E-08 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 NA 3.82E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 1.02E-06 NA mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 6.55E-07 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 1.09E-06 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209907443 NA 4.27E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251