\
| Variant ID: vg1209894319 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9894319 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )
ATACGAACATGCTAAGTGTTTCATATGTAATGCATCCCACGCACATTGCAGATTCCACTAGGTGCTGTTACTCTTCGACCTGGAGGCCTGCACCGTCAAC[A/G]
TATATGACTCAATGGATAAAAAAGAGTCTACGTTTGACAAGGTTTTCGAACTTATAGACAGGTATTGTCATAAGTTCCTATGTTAATTAAGAATCTTGTT
AACAAGATTCTTAATTAACATAGGAACTTATGACAATACCTGTCTATAAGTTCGAAAACCTTGTCAAACGTAGACTCTTTTTTATCCATTGAGTCATATA[T/C]
GTTGACGGTGCAGGCCTCCAGGTCGAAGAGTAACAGCACCTAGTGGAATCTGCAATGTGCGTGGGATGCATTACATATGAAACACTTAGCATGTTCGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 18.60% | 34.28% | 3.58% | NA |
| All Indica | 2759 | 46.20% | 13.90% | 37.84% | 2.03% | NA |
| All Japonica | 1512 | 43.50% | 31.10% | 24.07% | 1.39% | NA |
| Aus | 269 | 21.60% | 1.90% | 53.16% | 23.42% | NA |
| Indica I | 595 | 46.10% | 5.00% | 46.89% | 2.02% | NA |
| Indica II | 465 | 32.30% | 33.50% | 31.83% | 2.37% | NA |
| Indica III | 913 | 57.10% | 8.30% | 32.53% | 2.08% | NA |
| Indica Intermediate | 786 | 42.10% | 15.40% | 40.71% | 1.78% | NA |
| Temperate Japonica | 767 | 25.00% | 49.50% | 24.51% | 0.91% | NA |
| Tropical Japonica | 504 | 68.70% | 7.30% | 23.02% | 0.99% | NA |
| Japonica Intermediate | 241 | 49.40% | 22.00% | 24.90% | 3.73% | NA |
| VI/Aromatic | 96 | 31.20% | 2.10% | 42.71% | 23.96% | NA |
| Intermediate | 90 | 40.00% | 22.20% | 31.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209894319 | A -> DEL | N | N | silent_mutation | Average:25.087; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg1209894319 | A -> G | LOC_Os12g17290.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.087; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209894319 | NA | 4.69E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209894319 | NA | 9.89E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209894319 | NA | 6.68E-08 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209894319 | NA | 2.13E-06 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209894319 | 2.56E-07 | 2.06E-15 | mr1002_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209894319 | NA | 1.06E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209894319 | NA | 1.50E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209894319 | NA | 8.68E-07 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |