Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209890482:

Variant ID: vg1209890482 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9890482
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AATACAATATATGTTACTTTGCGTTTATCCTAATACATCTTTTTGTATGTTGCAGAAAAGACGTTGTCGTCGTCGTCCCTCAAGTCGGAGTGGTAGCTAG[C/T]
CCTCGAAGGAATTCGCGCAGGCAAGTGATGTAAATATATGATTGTTAGATTTTTAATGCAATTAAGACTATTAGATTTAATATACGACACTTAGACTTAG

Reverse complement sequence

CTAAGTCTAAGTGTCGTATATTAAATCTAATAGTCTTAATTGCATTAAAAATCTAACAATCATATATTTACATCACTTGCCTGCGCGAATTCCTTCGAGG[G/A]
CTAGCTACCACTCCGACTTGAGGGACGACGACGACAACGTCTTTTCTGCAACATACAAAAAGATGTATTAGGATAAACGCAAAGTAACATATATTGTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.50%	0.00%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	95.80%	4.20%	0.00%	0.00%	NA
Aus	269	28.60%	71.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209890482	C -> T	LOC_Os12g17280.1	upstream_gene_variant ; 3705.0bp to feature; MODIFIER	silent_mutation	Average:19.823; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N
vg1209890482	C -> T	LOC_Os12g17270.1	downstream_gene_variant ; 4763.0bp to feature; MODIFIER	silent_mutation	Average:19.823; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N
vg1209890482	C -> T	LOC_Os12g17290.1	intron_variant ; MODIFIER	silent_mutation	Average:19.823; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209890482	NA	1.10E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209890482	NA	5.29E-09	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209890482	NA	1.64E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209890482	2.83E-06	3.46E-09	mr1808_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251