\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209890482:

Variant ID: vg1209890482 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9890482
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AATACAATATATGTTACTTTGCGTTTATCCTAATACATCTTTTTGTATGTTGCAGAAAAGACGTTGTCGTCGTCGTCCCTCAAGTCGGAGTGGTAGCTAG[C/T]
CCTCGAAGGAATTCGCGCAGGCAAGTGATGTAAATATATGATTGTTAGATTTTTAATGCAATTAAGACTATTAGATTTAATATACGACACTTAGACTTAG

Reverse complement sequence

CTAAGTCTAAGTGTCGTATATTAAATCTAATAGTCTTAATTGCATTAAAAATCTAACAATCATATATTTACATCACTTGCCTGCGCGAATTCCTTCGAGG[G/A]
CTAGCTACCACTCCGACTTGAGGGACGACGACGACAACGTCTTTTCTGCAACATACAAAAAGATGTATTAGGATAAACGCAAAGTAACATATATTGTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.50% 0.00% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 95.80% 4.20% 0.00% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209890482 C -> T LOC_Os12g17280.1 upstream_gene_variant ; 3705.0bp to feature; MODIFIER silent_mutation Average:19.823; most accessible tissue: Minghui63 young leaf, score: 26.082 N N N N
vg1209890482 C -> T LOC_Os12g17270.1 downstream_gene_variant ; 4763.0bp to feature; MODIFIER silent_mutation Average:19.823; most accessible tissue: Minghui63 young leaf, score: 26.082 N N N N
vg1209890482 C -> T LOC_Os12g17290.1 intron_variant ; MODIFIER silent_mutation Average:19.823; most accessible tissue: Minghui63 young leaf, score: 26.082 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209890482 NA 1.10E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209890482 NA 5.29E-09 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209890482 NA 1.64E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209890482 2.83E-06 3.46E-09 mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251