\
| Variant ID: vg1209889554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9889554 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGCTTAATGAACTGGTGTAGTTCAGGTGGTTGGTTGGGCCTGTTGCAACGTGGTGTAGCGTTGGACAGTGATTGGTTAATATTGATTAATTACTACAGCT[A/G]
TTTTACTGCTTTCAACTACTGCTTTGAAATGTCTGCTTTATGCAAAAGAACCCCTAGCTTCCTTTGGTTATATCCTGCATCATACCTCCTCTTCCGGTAT
ATACCGGAAGAGGAGGTATGATGCAGGATATAACCAAAGGAAGCTAGGGGTTCTTTTGCATAAAGCAGACATTTCAAAGCAGTAGTTGAAAGCAGTAAAA[T/C]
AGCTGTAGTAATTAATCAATATTAACCAATCACTGTCCAACGCTACACCACGTTGCAACAGGCCCAACCAACCACCTGAACTACACCAGTTCATTAAGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 4.80% | 14.07% | 6.64% | NA |
| All Indica | 2759 | 76.90% | 1.70% | 14.43% | 6.96% | NA |
| All Japonica | 1512 | 68.50% | 11.60% | 11.84% | 8.00% | NA |
| Aus | 269 | 78.10% | 0.00% | 21.56% | 0.37% | NA |
| Indica I | 595 | 75.60% | 0.00% | 18.49% | 5.88% | NA |
| Indica II | 465 | 72.30% | 0.60% | 20.86% | 6.24% | NA |
| Indica III | 913 | 81.50% | 3.60% | 6.24% | 8.65% | NA |
| Indica Intermediate | 786 | 75.40% | 1.30% | 17.05% | 6.23% | NA |
| Temperate Japonica | 767 | 79.40% | 3.70% | 10.56% | 6.39% | NA |
| Tropical Japonica | 504 | 50.60% | 27.40% | 13.10% | 8.93% | NA |
| Japonica Intermediate | 241 | 71.40% | 4.10% | 13.28% | 11.20% | NA |
| VI/Aromatic | 96 | 79.20% | 2.10% | 18.75% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 4.40% | 13.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209889554 | A -> DEL | LOC_Os12g17290.1 | N | frameshift_variant | Average:36.72; most accessible tissue: Minghui63 young leaf, score: 77.654 | N | N | N | N |
| vg1209889554 | A -> G | LOC_Os12g17290.1 | missense_variant&splice_region_variant ; p.Tyr73Cys; MODERATE | nonsynonymous_codon ; Y73C | Average:36.72; most accessible tissue: Minghui63 young leaf, score: 77.654 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209889554 | 6.65E-06 | 2.37E-06 | mr1045_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | 6.02E-06 | 6.02E-06 | mr1169_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | 2.64E-06 | 1.18E-06 | mr1386_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | 1.25E-06 | 1.25E-06 | mr1641_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | 1.97E-06 | 1.97E-06 | mr1727_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | NA | 7.75E-06 | mr1759_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | 1.10E-06 | 2.87E-07 | mr1818_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | 6.76E-06 | 6.76E-06 | mr1960_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | 9.06E-06 | 9.06E-06 | mr1972_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209889554 | NA | 6.92E-07 | mr1986_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |