\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209889554:

Variant ID: vg1209889554 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9889554
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTTAATGAACTGGTGTAGTTCAGGTGGTTGGTTGGGCCTGTTGCAACGTGGTGTAGCGTTGGACAGTGATTGGTTAATATTGATTAATTACTACAGCT[A/G]
TTTTACTGCTTTCAACTACTGCTTTGAAATGTCTGCTTTATGCAAAAGAACCCCTAGCTTCCTTTGGTTATATCCTGCATCATACCTCCTCTTCCGGTAT

Reverse complement sequence

ATACCGGAAGAGGAGGTATGATGCAGGATATAACCAAAGGAAGCTAGGGGTTCTTTTGCATAAAGCAGACATTTCAAAGCAGTAGTTGAAAGCAGTAAAA[T/C]
AGCTGTAGTAATTAATCAATATTAACCAATCACTGTCCAACGCTACACCACGTTGCAACAGGCCCAACCAACCACCTGAACTACACCAGTTCATTAAGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 4.80% 14.07% 6.64% NA
All Indica  2759 76.90% 1.70% 14.43% 6.96% NA
All Japonica  1512 68.50% 11.60% 11.84% 8.00% NA
Aus  269 78.10% 0.00% 21.56% 0.37% NA
Indica I  595 75.60% 0.00% 18.49% 5.88% NA
Indica II  465 72.30% 0.60% 20.86% 6.24% NA
Indica III  913 81.50% 3.60% 6.24% 8.65% NA
Indica Intermediate  786 75.40% 1.30% 17.05% 6.23% NA
Temperate Japonica  767 79.40% 3.70% 10.56% 6.39% NA
Tropical Japonica  504 50.60% 27.40% 13.10% 8.93% NA
Japonica Intermediate  241 71.40% 4.10% 13.28% 11.20% NA
VI/Aromatic  96 79.20% 2.10% 18.75% 0.00% NA
Intermediate  90 82.20% 4.40% 13.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209889554 A -> DEL LOC_Os12g17290.1 N frameshift_variant Average:36.72; most accessible tissue: Minghui63 young leaf, score: 77.654 N N N N
vg1209889554 A -> G LOC_Os12g17290.1 missense_variant&splice_region_variant ; p.Tyr73Cys; MODERATE nonsynonymous_codon ; Y73C Average:36.72; most accessible tissue: Minghui63 young leaf, score: 77.654 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209889554 6.65E-06 2.37E-06 mr1045_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 6.02E-06 6.02E-06 mr1169_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 2.64E-06 1.18E-06 mr1386_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 1.25E-06 1.25E-06 mr1641_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 1.97E-06 1.97E-06 mr1727_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 NA 7.75E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 1.10E-06 2.87E-07 mr1818_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 6.76E-06 6.76E-06 mr1960_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 9.06E-06 9.06E-06 mr1972_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209889554 NA 6.92E-07 mr1986_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251