Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209878818:

Variant ID: vg1209878818 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9878818
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCCCCGGTTCATAACACCAACCGGGACTAAAGTCCCACCCCTATATATATGTCTTCTTCCTCCTCTAGCTGCCCGAGCAAGCTTCAAAATTTCTTCAA[A/G]
AAAGAGGGGAGGTCATGCCAAAATTTCTAGTGAATTTATTTTGGTGATTATATACAAAATCGGAGGTGCCTAAAAGGTTAGCAACTTCATCCTCCAATGT

Reverse complement sequence

ACATTGGAGGATGAAGTTGCTAACCTTTTAGGCACCTCCGATTTTGTATATAATCACCAAAATAAATTCACTAGAAATTTTGGCATGACCTCCCCTCTTT[T/C]
TTGAAGAAATTTTGAAGCTTGCTCGGGCAGCTAGAGGAGGAAGAAGACATATATATAGGGGTGGGACTTTAGTCCCGGTTGGTGTTATGAACCGGGGCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	7.40%	0.02%	0.00%	NA
All Indica	2759	98.70%	1.30%	0.00%	0.00%	NA
All Japonica	1512	95.80%	4.20%	0.00%	0.00%	NA
Aus	269	29.40%	70.60%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	45.80%	53.10%	1.04%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209878818	A -> G	LOC_Os12g17250.1	upstream_gene_variant ; 2395.0bp to feature; MODIFIER	silent_mutation	Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg1209878818	A -> G	LOC_Os12g17260.1	upstream_gene_variant ; 888.0bp to feature; MODIFIER	silent_mutation	Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg1209878818	A -> G	LOC_Os12g17270.1	upstream_gene_variant ; 4599.0bp to feature; MODIFIER	silent_mutation	Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg1209878818	A -> G	LOC_Os12g17250-LOC_Os12g17260	intergenic_region ; MODIFIER	silent_mutation	Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209878818	1.07E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818	2.21E-08	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818	5.78E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818	NA	3.43E-07	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818	2.44E-06	NA	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818	NA	5.41E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818	NA	1.82E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818	6.24E-06	NA	mr1888_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251