\
| Variant ID: vg1209878818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9878818 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGCCCCGGTTCATAACACCAACCGGGACTAAAGTCCCACCCCTATATATATGTCTTCTTCCTCCTCTAGCTGCCCGAGCAAGCTTCAAAATTTCTTCAA[A/G]
AAAGAGGGGAGGTCATGCCAAAATTTCTAGTGAATTTATTTTGGTGATTATATACAAAATCGGAGGTGCCTAAAAGGTTAGCAACTTCATCCTCCAATGT
ACATTGGAGGATGAAGTTGCTAACCTTTTAGGCACCTCCGATTTTGTATATAATCACCAAAATAAATTCACTAGAAATTTTGGCATGACCTCCCCTCTTT[T/C]
TTGAAGAAATTTTGAAGCTTGCTCGGGCAGCTAGAGGAGGAAGAAGACATATATATAGGGGTGGGACTTTAGTCCCGGTTGGTGTTATGAACCGGGGCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.60% | 7.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.40% | 70.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 53.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209878818 | A -> G | LOC_Os12g17250.1 | upstream_gene_variant ; 2395.0bp to feature; MODIFIER | silent_mutation | Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1209878818 | A -> G | LOC_Os12g17260.1 | upstream_gene_variant ; 888.0bp to feature; MODIFIER | silent_mutation | Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1209878818 | A -> G | LOC_Os12g17270.1 | upstream_gene_variant ; 4599.0bp to feature; MODIFIER | silent_mutation | Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1209878818 | A -> G | LOC_Os12g17250-LOC_Os12g17260 | intergenic_region ; MODIFIER | silent_mutation | Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209878818 | 1.07E-06 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878818 | 2.21E-08 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878818 | 5.78E-07 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878818 | NA | 3.43E-07 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878818 | 2.44E-06 | NA | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878818 | NA | 5.41E-06 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878818 | NA | 1.82E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878818 | 6.24E-06 | NA | mr1888_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |