\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209878818:

Variant ID: vg1209878818 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9878818
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCCCCGGTTCATAACACCAACCGGGACTAAAGTCCCACCCCTATATATATGTCTTCTTCCTCCTCTAGCTGCCCGAGCAAGCTTCAAAATTTCTTCAA[A/G]
AAAGAGGGGAGGTCATGCCAAAATTTCTAGTGAATTTATTTTGGTGATTATATACAAAATCGGAGGTGCCTAAAAGGTTAGCAACTTCATCCTCCAATGT

Reverse complement sequence

ACATTGGAGGATGAAGTTGCTAACCTTTTAGGCACCTCCGATTTTGTATATAATCACCAAAATAAATTCACTAGAAATTTTGGCATGACCTCCCCTCTTT[T/C]
TTGAAGAAATTTTGAAGCTTGCTCGGGCAGCTAGAGGAGGAAGAAGACATATATATAGGGGTGGGACTTTAGTCCCGGTTGGTGTTATGAACCGGGGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.40% 0.02% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 95.80% 4.20% 0.00% 0.00% NA
Aus  269 29.40% 70.60% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 53.10% 1.04% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209878818 A -> G LOC_Os12g17250.1 upstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg1209878818 A -> G LOC_Os12g17260.1 upstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg1209878818 A -> G LOC_Os12g17270.1 upstream_gene_variant ; 4599.0bp to feature; MODIFIER silent_mutation Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg1209878818 A -> G LOC_Os12g17250-LOC_Os12g17260 intergenic_region ; MODIFIER silent_mutation Average:29.956; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209878818 1.07E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818 2.21E-08 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818 5.78E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818 NA 3.43E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818 2.44E-06 NA mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818 NA 5.41E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818 NA 1.82E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209878818 6.24E-06 NA mr1888_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251