\
| Variant ID: vg1209878209 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9878209 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )
TGATCTATTGTTCCGTGTCCCCTCTCCTCCTAGGGGGCCTTGTATTTATACCCATAGGTGTCCCCTTATCCAAGTAGAACTAGGGAAACCATTATGGATA[C/T]
AATCCGAGTAGTACTTGTCGTTTCCATGTAGAACTCTATTCATCCTTCCTTATGCGGAACTCCTCCTATATCCGAAGATTGTTTCCGTATAAGACATGGT
ACCATGTCTTATACGGAAACAATCTTCGGATATAGGAGGAGTTCCGCATAAGGAAGGATGAATAGAGTTCTACATGGAAACGACAAGTACTACTCGGATT[G/A]
TATCCATAATGGTTTCCCTAGTTCTACTTGGATAAGGGGACACCTATGGGTATAAATACAAGGCCCCCTAGGAGGAGAGGGGACACGGAACAATAGATCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209878209 | C -> T | LOC_Os12g17250.1 | upstream_gene_variant ; 1786.0bp to feature; MODIFIER | silent_mutation | Average:55.429; most accessible tissue: Minghui63 young leaf, score: 80.883 | N | N | N | N |
| vg1209878209 | C -> T | LOC_Os12g17260.1 | upstream_gene_variant ; 1497.0bp to feature; MODIFIER | silent_mutation | Average:55.429; most accessible tissue: Minghui63 young leaf, score: 80.883 | N | N | N | N |
| vg1209878209 | C -> T | LOC_Os12g17250-LOC_Os12g17260 | intergenic_region ; MODIFIER | silent_mutation | Average:55.429; most accessible tissue: Minghui63 young leaf, score: 80.883 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209878209 | NA | 4.20E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 1.80E-06 | NA | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 6.95E-07 | NA | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 2.46E-07 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 5.93E-07 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 2.73E-07 | NA | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | NA | 2.04E-08 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 4.71E-06 | NA | mr1613 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 7.29E-07 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 8.79E-08 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 3.64E-06 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 5.24E-09 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 2.17E-08 | NA | mr1203_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | NA | 3.38E-08 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 9.29E-08 | NA | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 9.04E-06 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209878209 | 4.69E-06 | NA | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |