Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209877862:

Variant ID: vg1209877862 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9877862
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AGATGGAGATAGGGATTTTTATACACGTTCGGGCTCCTGCATTGTCAAGTAATGACCCTACTGTTGGCCGAAGCCGGTTGTTACTCTTATTCACCATAAT[C/A,T]
ACACCAGTATAATATTTGGGGTAGCCTATCTAACTGTTGTCGACTTGATGGTCTGAAGTGTTGACTCGTAGTCGACAATAGGGTAGCATTCCTCCTCGAA

Reverse complement sequence

TTCGAGGAGGAATGCTACCCTATTGTCGACTACGAGTCAACACTTCAGACCATCAAGTCGACAACAGTTAGATAGGCTACCCCAAATATTATACTGGTGT[G/T,A]
ATTATGGTGAATAAGAGTAACAACCGGCTTCGGCCAACAGTAGGGTCATTACTTGACAATGCAGGAGCCCGAACGTGTATAAAAATCCCTATCTCCATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	5.60%	1.10%	0.66%	NA
All Indica	2759	98.70%	1.30%	0.04%	0.04%	NA
All Japonica	1512	95.80%	4.20%	0.07%	0.00%	NA
Aus	269	30.50%	45.70%	15.99%	7.81%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	98.60%	1.30%	0.00%	0.11%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.40%	0.41%	0.00%	NA
VI/Aromatic	96	49.00%	35.40%	6.25%	9.38%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209877862	C -> DEL	N	N	silent_mutation	Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg1209877862	C -> A	LOC_Os12g17250.1	upstream_gene_variant ; 1439.0bp to feature; MODIFIER	silent_mutation	Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg1209877862	C -> A	LOC_Os12g17260.1	upstream_gene_variant ; 1844.0bp to feature; MODIFIER	silent_mutation	Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg1209877862	C -> A	LOC_Os12g17250-LOC_Os12g17260	intergenic_region ; MODIFIER	silent_mutation	Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg1209877862	C -> T	LOC_Os12g17250.1	upstream_gene_variant ; 1439.0bp to feature; MODIFIER	N	Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg1209877862	C -> T	LOC_Os12g17260.1	upstream_gene_variant ; 1844.0bp to feature; MODIFIER	N	Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N
vg1209877862	C -> T	LOC_Os12g17250-LOC_Os12g17260	intergenic_region ; MODIFIER	N	Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209877862	4.45E-07	NA	mr1613	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209877862	8.00E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209877862	2.34E-06	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209877862	NA	4.61E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251