\
| Variant ID: vg1209877862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9877862 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 254. )
AGATGGAGATAGGGATTTTTATACACGTTCGGGCTCCTGCATTGTCAAGTAATGACCCTACTGTTGGCCGAAGCCGGTTGTTACTCTTATTCACCATAAT[C/A,T]
ACACCAGTATAATATTTGGGGTAGCCTATCTAACTGTTGTCGACTTGATGGTCTGAAGTGTTGACTCGTAGTCGACAATAGGGTAGCATTCCTCCTCGAA
TTCGAGGAGGAATGCTACCCTATTGTCGACTACGAGTCAACACTTCAGACCATCAAGTCGACAACAGTTAGATAGGCTACCCCAAATATTATACTGGTGT[G/T,A]
ATTATGGTGAATAAGAGTAACAACCGGCTTCGGCCAACAGTAGGGTCATTACTTGACAATGCAGGAGCCCGAACGTGTATAAAAATCCCTATCTCCATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 5.60% | 1.10% | 0.66% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 95.80% | 4.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 30.50% | 45.70% | 15.99% | 7.81% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 35.40% | 6.25% | 9.38% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209877862 | C -> DEL | N | N | silent_mutation | Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg1209877862 | C -> A | LOC_Os12g17250.1 | upstream_gene_variant ; 1439.0bp to feature; MODIFIER | silent_mutation | Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg1209877862 | C -> A | LOC_Os12g17260.1 | upstream_gene_variant ; 1844.0bp to feature; MODIFIER | silent_mutation | Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg1209877862 | C -> A | LOC_Os12g17250-LOC_Os12g17260 | intergenic_region ; MODIFIER | silent_mutation | Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg1209877862 | C -> T | LOC_Os12g17250.1 | upstream_gene_variant ; 1439.0bp to feature; MODIFIER | N | Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg1209877862 | C -> T | LOC_Os12g17260.1 | upstream_gene_variant ; 1844.0bp to feature; MODIFIER | N | Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| vg1209877862 | C -> T | LOC_Os12g17250-LOC_Os12g17260 | intergenic_region ; MODIFIER | N | Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209877862 | 4.45E-07 | NA | mr1613 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209877862 | 8.00E-06 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209877862 | 2.34E-06 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209877862 | NA | 4.61E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |