Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209877862:

Variant ID: vg1209877862 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9877862
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AGATGGAGATAGGGATTTTTATACACGTTCGGGCTCCTGCATTGTCAAGTAATGACCCTACTGTTGGCCGAAGCCGGTTGTTACTCTTATTCACCATAAT[C/A,T]
ACACCAGTATAATATTTGGGGTAGCCTATCTAACTGTTGTCGACTTGATGGTCTGAAGTGTTGACTCGTAGTCGACAATAGGGTAGCATTCCTCCTCGAA

Reverse complement sequence

TTCGAGGAGGAATGCTACCCTATTGTCGACTACGAGTCAACACTTCAGACCATCAAGTCGACAACAGTTAGATAGGCTACCCCAAATATTATACTGGTGT[G/T,A]
ATTATGGTGAATAAGAGTAACAACCGGCTTCGGCCAACAGTAGGGTCATTACTTGACAATGCAGGAGCCCGAACGTGTATAAAAATCCCTATCTCCATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 5.60% 1.10% 0.66% NA
All Indica  2759 98.70% 1.30% 0.04% 0.04% NA
All Japonica  1512 95.80% 4.20% 0.07% 0.00% NA
Aus  269 30.50% 45.70% 15.99% 7.81% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 98.60% 1.30% 0.00% 0.11% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.40% 0.41% 0.00% NA
VI/Aromatic  96 49.00% 35.40% 6.25% 9.38% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209877862 C -> DEL N N silent_mutation Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg1209877862 C -> A LOC_Os12g17250.1 upstream_gene_variant ; 1439.0bp to feature; MODIFIER silent_mutation Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg1209877862 C -> A LOC_Os12g17260.1 upstream_gene_variant ; 1844.0bp to feature; MODIFIER silent_mutation Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg1209877862 C -> A LOC_Os12g17250-LOC_Os12g17260 intergenic_region ; MODIFIER silent_mutation Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg1209877862 C -> T LOC_Os12g17250.1 upstream_gene_variant ; 1439.0bp to feature; MODIFIER N Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg1209877862 C -> T LOC_Os12g17260.1 upstream_gene_variant ; 1844.0bp to feature; MODIFIER N Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N
vg1209877862 C -> T LOC_Os12g17250-LOC_Os12g17260 intergenic_region ; MODIFIER N Average:67.343; most accessible tissue: Zhenshan97 young leaf, score: 82.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209877862 4.45E-07 NA mr1613 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209877862 8.00E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209877862 2.34E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209877862 NA 4.61E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251