\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209876216:

Variant ID: vg1209876216 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9876216
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 141. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCGCACATCATGCAAAGCTGAAGCGATGAAGACAAGACCTTAATCTGTGTTGTCTCTCTAATATCTTTCTCGTTAATTAATTTTCTAGACCATGTTTA[G/T]
TGATAATGGGTAATTAACATGCTAATGGGCTCACGTTTGCTGCCTACCTAGCCTTGTTACGTAAAGCACCAGGGGAGGGGGAGTGTCGGATAGGGGGGTG

Reverse complement sequence

CACCCCCCTATCCGACACTCCCCCTCCCCTGGTGCTTTACGTAACAAGGCTAGGTAGGCAGCAAACGTGAGCCCATTAGCATGTTAATTACCCATTATCA[C/A]
TAAACATGGTCTAGAAAATTAATTAACGAGAAAGATATTAGAGAGACAACACAGATTAAGGTCTTGTCTTCATCGCTTCAGCTTTGCATGATGTGCGCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 8.70% 2.26% 9.92% NA
All Indica  2759 79.50% 11.80% 2.36% 6.38% NA
All Japonica  1512 77.20% 4.60% 2.25% 15.94% NA
Aus  269 85.50% 3.00% 1.12% 10.41% NA
Indica I  595 94.80% 1.00% 0.67% 3.53% NA
Indica II  465 92.30% 4.10% 1.94% 1.72% NA
Indica III  913 60.70% 24.60% 4.16% 10.51% NA
Indica Intermediate  786 82.20% 9.50% 1.78% 6.49% NA
Temperate Japonica  767 81.90% 1.60% 2.74% 13.82% NA
Tropical Japonica  504 77.40% 2.80% 0.60% 19.25% NA
Japonica Intermediate  241 61.80% 18.30% 4.15% 15.77% NA
VI/Aromatic  96 80.20% 0.00% 3.12% 16.67% NA
Intermediate  90 81.10% 7.80% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209876216 G -> DEL N N silent_mutation Average:93.195; most accessible tissue: Minghui63 flag leaf, score: 97.555 N N N N
vg1209876216 G -> T LOC_Os12g17240.1 upstream_gene_variant ; 4632.0bp to feature; MODIFIER silent_mutation Average:93.195; most accessible tissue: Minghui63 flag leaf, score: 97.555 N N N N
vg1209876216 G -> T LOC_Os12g17260.1 upstream_gene_variant ; 3490.0bp to feature; MODIFIER silent_mutation Average:93.195; most accessible tissue: Minghui63 flag leaf, score: 97.555 N N N N
vg1209876216 G -> T LOC_Os12g17250.1 intron_variant ; MODIFIER silent_mutation Average:93.195; most accessible tissue: Minghui63 flag leaf, score: 97.555 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209876216 G T -0.01 0.0 0.0 -0.03 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209876216 8.55E-08 8.55E-08 mr1008 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 3.04E-06 3.04E-06 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 9.69E-06 NA mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.34E-08 1.34E-08 mr1065 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.66E-07 1.66E-07 mr1067 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 8.17E-06 8.17E-06 mr1068 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 6.40E-06 NA mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 2.88E-06 NA mr1090 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 7.69E-07 NA mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 NA 7.01E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.62E-08 1.62E-08 mr1141 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 4.36E-06 NA mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 9.94E-08 9.94E-08 mr1191 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 3.44E-06 3.44E-06 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 9.81E-06 9.81E-06 mr1237 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.18E-06 NA mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 NA 6.59E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 9.90E-09 9.67E-08 mr1517 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 5.98E-06 5.98E-06 mr1526 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.37E-11 1.37E-11 mr1542 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.20E-06 5.57E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 NA 2.84E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.16E-06 1.16E-06 mr1644 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 5.42E-10 5.42E-10 mr1750 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 3.36E-07 NA mr1771 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 9.18E-08 2.30E-07 mr1865 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 2.09E-06 2.89E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 7.69E-07 7.69E-07 mr1970 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 5.84E-07 5.84E-07 mr1973 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209876216 1.36E-06 1.36E-06 mr1987 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251