\
| Variant ID: vg1209814801 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9814801 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 97. )
GTTATGTTTGTGATTATGTGGTAGTCCTTCAGATCGTGTATGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGGCAGGATCCAC[C/T]
ACATACCATGTTTTATACGGAAACTGACCTCGAGGGAGTTCCGGATAAGGAAAGACAACTAGAGTTCTACATGAAAATGACAAGGACTACTCGGATTGTA
TACAATCCGAGTAGTCCTTGTCATTTTCATGTAGAACTCTAGTTGTCTTTCCTTATCCGGAACTCCCTCGAGGTCAGTTTCCGTATAAAACATGGTATGT[G/A]
GTGGATCCTGCCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACATACACGATCTGAAGGACTACCACATAATCACAAACATAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 34.30% | 0.28% | 2.90% | NA |
| All Indica | 2759 | 42.30% | 55.30% | 0.33% | 2.07% | NA |
| All Japonica | 1512 | 95.10% | 3.30% | 0.07% | 1.52% | NA |
| Aus | 269 | 79.90% | 1.10% | 0.74% | 18.22% | NA |
| Indica I | 595 | 55.30% | 44.00% | 0.34% | 0.34% | NA |
| Indica II | 465 | 49.90% | 50.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 29.00% | 67.00% | 0.22% | 3.72% | NA |
| Indica Intermediate | 786 | 43.40% | 53.30% | 0.64% | 2.67% | NA |
| Temperate Japonica | 767 | 92.00% | 5.20% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 97.60% | 2.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 71.90% | 22.90% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 74.40% | 21.10% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209814801 | C -> DEL | N | N | silent_mutation | Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg1209814801 | C -> T | LOC_Os12g17140.1 | upstream_gene_variant ; 2331.0bp to feature; MODIFIER | silent_mutation | Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg1209814801 | C -> T | LOC_Os12g17150.1 | upstream_gene_variant ; 879.0bp to feature; MODIFIER | silent_mutation | Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg1209814801 | C -> T | LOC_Os12g17140-LOC_Os12g17150 | intergenic_region ; MODIFIER | silent_mutation | Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209814801 | NA | 1.47E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209814801 | NA | 5.33E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209814801 | NA | 4.53E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209814801 | NA | 7.17E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209814801 | NA | 3.29E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209814801 | 2.33E-06 | 3.08E-13 | mr1002_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209814801 | NA | 6.32E-06 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209814801 | NA | 5.26E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |