Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209814801:

Variant ID: vg1209814801 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9814801
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

GTTATGTTTGTGATTATGTGGTAGTCCTTCAGATCGTGTATGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGGCAGGATCCAC[C/T]
ACATACCATGTTTTATACGGAAACTGACCTCGAGGGAGTTCCGGATAAGGAAAGACAACTAGAGTTCTACATGAAAATGACAAGGACTACTCGGATTGTA

Reverse complement sequence

TACAATCCGAGTAGTCCTTGTCATTTTCATGTAGAACTCTAGTTGTCTTTCCTTATCCGGAACTCCCTCGAGGTCAGTTTCCGTATAAAACATGGTATGT[G/A]
GTGGATCCTGCCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACATACACGATCTGAAGGACTACCACATAATCACAAACATAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	34.30%	0.28%	2.90%	NA
All Indica	2759	42.30%	55.30%	0.33%	2.07%	NA
All Japonica	1512	95.10%	3.30%	0.07%	1.52%	NA
Aus	269	79.90%	1.10%	0.74%	18.22%	NA
Indica I	595	55.30%	44.00%	0.34%	0.34%	NA
Indica II	465	49.90%	50.10%	0.00%	0.00%	NA
Indica III	913	29.00%	67.00%	0.22%	3.72%	NA
Indica Intermediate	786	43.40%	53.30%	0.64%	2.67%	NA
Temperate Japonica	767	92.00%	5.20%	0.00%	2.74%	NA
Tropical Japonica	504	97.60%	2.00%	0.20%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	71.90%	22.90%	0.00%	5.21%	NA
Intermediate	90	74.40%	21.10%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209814801	C -> DEL	N	N	silent_mutation	Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1209814801	C -> T	LOC_Os12g17140.1	upstream_gene_variant ; 2331.0bp to feature; MODIFIER	silent_mutation	Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1209814801	C -> T	LOC_Os12g17150.1	upstream_gene_variant ; 879.0bp to feature; MODIFIER	silent_mutation	Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1209814801	C -> T	LOC_Os12g17140-LOC_Os12g17150	intergenic_region ; MODIFIER	silent_mutation	Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209814801	NA	1.47E-06	mr1002	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801	NA	5.33E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801	NA	4.53E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801	NA	7.17E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801	NA	3.29E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801	2.33E-06	3.08E-13	mr1002_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801	NA	6.32E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801	NA	5.26E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251