\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209814801:

Variant ID: vg1209814801 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9814801
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATGTTTGTGATTATGTGGTAGTCCTTCAGATCGTGTATGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACTAAATCTCGGCAGGATCCAC[C/T]
ACATACCATGTTTTATACGGAAACTGACCTCGAGGGAGTTCCGGATAAGGAAAGACAACTAGAGTTCTACATGAAAATGACAAGGACTACTCGGATTGTA

Reverse complement sequence

TACAATCCGAGTAGTCCTTGTCATTTTCATGTAGAACTCTAGTTGTCTTTCCTTATCCGGAACTCCCTCGAGGTCAGTTTCCGTATAAAACATGGTATGT[G/A]
GTGGATCCTGCCGAGATTTAGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACATACACGATCTGAAGGACTACCACATAATCACAAACATAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 34.30% 0.28% 2.90% NA
All Indica  2759 42.30% 55.30% 0.33% 2.07% NA
All Japonica  1512 95.10% 3.30% 0.07% 1.52% NA
Aus  269 79.90% 1.10% 0.74% 18.22% NA
Indica I  595 55.30% 44.00% 0.34% 0.34% NA
Indica II  465 49.90% 50.10% 0.00% 0.00% NA
Indica III  913 29.00% 67.00% 0.22% 3.72% NA
Indica Intermediate  786 43.40% 53.30% 0.64% 2.67% NA
Temperate Japonica  767 92.00% 5.20% 0.00% 2.74% NA
Tropical Japonica  504 97.60% 2.00% 0.20% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 71.90% 22.90% 0.00% 5.21% NA
Intermediate  90 74.40% 21.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209814801 C -> DEL N N silent_mutation Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg1209814801 C -> T LOC_Os12g17140.1 upstream_gene_variant ; 2331.0bp to feature; MODIFIER silent_mutation Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg1209814801 C -> T LOC_Os12g17150.1 upstream_gene_variant ; 879.0bp to feature; MODIFIER silent_mutation Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg1209814801 C -> T LOC_Os12g17140-LOC_Os12g17150 intergenic_region ; MODIFIER silent_mutation Average:39.629; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209814801 NA 1.47E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801 NA 5.33E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801 NA 4.53E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801 NA 7.17E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801 NA 3.29E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801 2.33E-06 3.08E-13 mr1002_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801 NA 6.32E-06 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209814801 NA 5.26E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251