Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209813313:

Variant ID: vg1209813313 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9813313
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.36, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGCCGGTCAGACCGAGCAGTGGGCGCCGATCAGACCGGAGGTGTCCGAGCGGTCTAACCGGGTAGCATGACGGTCTGACCAGCAGACTCCAGGAGGGA[A/G]
TCGGTTTCGGGTTGTTTTCGTGGAATTTCTAGATTGCTTCATGTTTATGACTACTAGATTGTTTTTATTCATATGTGATACTATGTGTGCTGATATGAGT

Reverse complement sequence

ACTCATATCAGCACACATAGTATCACATATGAATAAAAACAATCTAGTAGTCATAAACATGAAGCAATCTAGAAATTCCACGAAAACAACCCGAAACCGA[T/C]
TCCCTCCTGGAGTCTGCTGGTCAGACCGTCATGCTACCCGGTTAGACCGCTCGGACACCTCCGGTCTGATCGGCGCCCACTGCTCGGTCTGACCGGCTCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.80%	30.60%	0.72%	1.82%	NA
All Indica	2759	62.60%	33.20%	1.12%	3.08%	NA
All Japonica	1512	84.60%	15.20%	0.13%	0.07%	NA
Aus	269	22.30%	77.70%	0.00%	0.00%	NA
Indica I	595	47.40%	46.20%	3.19%	3.19%	NA
Indica II	465	61.90%	37.40%	0.22%	0.43%	NA
Indica III	913	73.60%	21.20%	0.77%	4.38%	NA
Indica Intermediate	786	61.60%	34.90%	0.51%	3.05%	NA
Temperate Japonica	767	94.00%	5.70%	0.26%	0.00%	NA
Tropical Japonica	504	72.00%	28.00%	0.00%	0.00%	NA
Japonica Intermediate	241	80.90%	18.70%	0.00%	0.41%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209813313	A -> DEL	N	N	silent_mutation	Average:74.416; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N
vg1209813313	A -> G	LOC_Os12g17140.1	upstream_gene_variant ; 843.0bp to feature; MODIFIER	silent_mutation	Average:74.416; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N
vg1209813313	A -> G	LOC_Os12g17150.1	upstream_gene_variant ; 2367.0bp to feature; MODIFIER	silent_mutation	Average:74.416; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N
vg1209813313	A -> G	LOC_Os12g17140-LOC_Os12g17150	intergenic_region ; MODIFIER	silent_mutation	Average:74.416; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209813313	NA	7.02E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813313	NA	5.15E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813313	5.41E-08	NA	mr1719	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813313	NA	3.85E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813313	NA	9.88E-10	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813313	NA	2.41E-06	mr1425_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209813313	NA	4.19E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251